авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Молекулярный и микробиологический мониторинг становления микрофлоры кишечника новорожденных

На правах рукописи

Донских Екатерина Евгеньевна

Молекулярный и микробиологический мониторинг становления

микрофлоры кишечника новорожденных

03.02.03.- микробиология

Автореферат

диссертации на соискание ученой степени

кандидата биологических наук

МОСКВА – 2010

1

Работа выполнена в Государственном Образовательном Учреждении Высшего профессионального образования «Российский Государственный Медицинский Университет Федерального агентства по здравоохранению и социальному развитию».

Научные руководители:

доктор медицинских наук, профессор Кафарская Людмила Ивановна доктор медицинских наук, профессор Ефимов Борис Алексеевич

Официальные оппоненты:

доктор биологических наук, профессор Л.П. Блинкова доктор медицинских наук, профессор Ю. В. Несвижский

Ведущая организация:

ГОУ ВПО Московский медико-стоматологический университет Росздрава.

Защита диссертации состоится « » _ 2010 г. в _ час.

на заседании диссертационного совета Д 208.046.01 при Федеральном Государственном учреждении науки «Московский научно-исследовательский институт эпидемиологии и микробиологии им Г.Н. Габричевского» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека по адресу: 125212, Москва, ул. Адмирала Макарова, д.10.

С диссертацией можно ознакомиться в библиотеке ФГУН «Московский научно исследовательский институт эпидемиологии и микробиологии им. Г.Н. Габричевского»

Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека.

Автореферат разослан « » 2010 г.

Ученый секретарь диссертационного совета доктор медицинских наук О.Ю. Борисова

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы Поверхность слизистых оболочек является местом наиболее тесного взаимодействия организма хозяина с колонизирующими его микроорганизмами, причем слизистая кишечника представляет собой наиболее значительную область такого контакта. Являясь местом обитания многочисленного бактериального сообщества, отделенного от внутренней среды организма только монослоем эпителиальных клеток, кишечник адаптирован для двусторонних обменных процессов хозяин-микрофлора. Количество резидентных бактерий, обитающих в кишечнике, десятикратно превосходит число человеческих соматических клеток, а совокупный микробный геном намного превышает геном человека (Shanahan F., 2002). Структура и состав кишечной микрофлоры отражает процессы естественного отбора, протекающие как внутри самого микробного сообщества, так и на уровне его взаимодействия с организмом хозяина (Palmer C., 2007) Роль нормальной индигенной микрофлоры все еще недостаточно изучена, но одна из наиболее важных ее функций, вероятно, заключается в поддержании колонизационной резистентности против внешней паразитарной экспансии, а также в контроле над чрезмерным ростом потенциальных патогенов, уже присутствующих в кишечнике (Гончарова Г.И., 1982). Антагонистическая активность индигенной микрофлоры обусловлена различными механизмами, прежде всего биохимическими: способностью продуцировать органические кислоты, бактериоцины и другие антимикробные субстанции (Лянная А.М., 1975;

Johnson M.G., 1998;

Walker W.A., 2008).

Формирование нормальной микрофлоры кишечника человека начинается еще на самых ранних этапах жизни. Считается, что первичным источником бактерий, колонизирующих пищеварительный тракт ребенка, являются родовые пути матери, во время прохождения которых новорожденный заглатывает их содержимое вместе с бактериями вагинальной микрофлоры. После рождения колонизация кишечника ребенка продолжается не только штаммами бактерий поступающих от матери, но и микроорганизмами от других источников находящихся во внешней среде (Fanaro S., 2003). Однако указанные предположения, касающиеся участия материнских штаммов бактерий в первичной колонизации гастроинтестинального тракта ребенка, до последнего времени остаются недостаточно подтвержденными научными данными. Это, в свою очередь связано с малой информативностью используемых для решения данной задачи микробиологических методов, которые основаны, прежде всего, на изучении морфологических, физиолого-биохимических и культуральных свойств бактериальных штаммов, изолируемых из материнских и детских источников.

Активное внедрение молекулярно-генетических технологий в практику микробиологических исследований позволило получить новую информацию о составе и свойствах интестинальной микрофлоры у людей разного возраста (Favier C.F., 2002;

Furrie E., 2006;

Амерханова А.М., 2009). В последние годы был разработан целый арсенал методов с использованием полимеразной цепной реакции, позволяющих не только быстро и достоверно определить видовую принадлежность выделяемых микроорганизмов, но и проводить их количественную оценку непосредственно в исследуемом материале без этапа культивирования.

Среди большого разнообразия бактериальных видов, колонизирующих толстый кишечник, особого внимания заслуживают бактерии рода Bifidobacterium. В толстой кишке у детей раннего возраста бифидобактерии являются основной группой и составляют до 95% от общей популяции микроорганизмов (Гончарова Г.И., 1986;

Tannock G.W., 1994;

Reuter G., 2001;

Shanahan F., 2002;



Tapianinen T., 2006;

Gronlund M.M., 2007).

Благодаря исключительно позитивному воздействию бифидобактерий на локальный статус пищеварительного тракта, а также их системному иммуномодулирующему эффекту, бифидобактерии стали объектом многочисленных научных исследований, и широко используются в качестве пробиотических препаратов (Гончарова Г.И.,1989;

Бондаренко В.М., 1995).

Вместе с тем, до последнего времени данные о видовых и штаммовых изменениях, происходящих в составе бифидофлоры у людей по мере взросления, остаются ограниченными.

В этой связи, очевидна актуальность проведения сравнительного мониторинга нормальной микрофлоры толстого кишечника у клинически здоровых детей в динамике с привлечением методов молекулярно-генетической идентификации и типирования штаммов бифидобактерий.

Цель исследования С использованием бактериологических и молекулярно-генетических методов провести мониторинг становления видового состава бифидобактерий у детей, а также путем сравнительного генетического анализа штаммов бифидобактерий, выделенных в парах мать-ребенок, выявить особенности транслокации материнских штаммов бифидобактерий кишечного происхождения к ребенку.

Задачи исследования 1. Изучить в динамике качественный и количественный состав микрофлоры толстого кишечника у клинически здоровых детей разного возраста.

2. Создать коллекцию штаммов бифидобактерий, выделенных из кишечника детей разных возрастных групп и провести их видовую идентификацию при помощи молекулярно-генетических методов.

3. Создать коллекцию штаммов бифидобактерий, выделенных из кишечника детей раннего возраста и их матерей, и провести сравнительный анализ при помощи метода REP-ПЦР и RAPD-ПЦР для установления их генетической идентичности.

Научная новизна исследования Идентификация бифидобактерий проведена с использованием ПЦР с видоспецифичными бифидобактериальными праймерами. Проведено частичное секвенирование 16S рДНК бифидобактерий, выделенных из кишечника детей разного возраста и взрослых женщин, что позволило провести оценку динамики возрастных изменений бифидофлоры.

Впервые с использованием метода REP-ПЦР проведен сравнительный анализ штаммов бифидобактерий в парах мать-ребенок для установления их генетической идентичности. Полученные результаты свидетельствуют в пользу существующей гипотезы о ранней колонизации детей материнскими штаммами бифидобактерий.

Впервые исследовано субвидовое штаммовое разнообразие кишечных бифидобактерий у детей раннего возраста методом RAPD-ПЦР и получены данные о транслокации материнских штаммов от матери к ребнку.

Практическая значимость Создана коллекция штаммов бифидобактерий, выделенных из кишечника здоровых детей и взрослых людей, включающая практически все виды микроорганизмов данного рода, обитающие в интестинальном микробиоценозе. Видовая принадлежность полученных штаммов определена при помощи высокочувствительных молекулярных методов, что повышает ценность этой коллекции. Часть штаммов бифидобактерий была подвергнута генетической паспортизации методами и REP-ПЦР RAPD-ПЦР фингерпринтинга.

Полученные данные о качественном и количественном составе бифидофлоры у детей различного возраста и взрослых людей могут быть использованы как критерии нормы при оценке различных нарушений микрофлоры кишечного тракта, а также для подбора оптимального видового (штаммового) состава бифидобактерий, включаемых в пробиотические препараты и используемых с целью купирования нарушений кишечной микрофлоры.

Внедрение результатов работы в практику В настоящее время штаммы из созданной коллекции используются сотрудниками кафедры микробиологии и вирусологии ГОУ ВПО РГМУ Росздрава для изучения разнообразных биологических свойств бифидобактерий (акт от 17.02.2010 г.) Результаты исследования включены в материалы лекционного курса для студентов, врачей-интернов и клинических ординаторов, проходящих обучение на кафедре микробиологии и вирусологии ГОУ ВПО РГМУ Росздрава.

Положения, выносимые на защиту 1. На протяжении первых лет жизни в популяции бифидобактерий микрофлоры кишечника у здоровых детей наблюдаются выраженные качественные и количественные изменения. В ранние периоды физиологической адаптации для микрофлоры кишечника у детей характерны высокие популяционные уровни и частота выделения бифидобактерий видов B. bifidum, B. longum и B.breve. Кроме того, у детей в первые шесть месяцев после рождения к этой группе относятся и бифидобактерии B.longum bv. infantis. У детей в возрасте 6 лет и у взрослых бифидофлора, в основном, представлена видами B. longum, B.

adolescentis, B. catenulatum и B. bifidum.

2. Молекулярно-генетические методы, основанные на амплификационной технологии (REP-ПЦР и RAPD-ПЦР), позволяют эффективно решать задачи по молекулярно генетическому типированию бифидобактерий с целью установления уровня их внутривидовых вариаций в микрофлоре кишечника у детей и взрослых людей.

Апробация работы Апробация диссертационной работы состоялась на научной конференции кафедры микробиологии и вирусологии ГОУ ВПО РГМУ протокол № 3 от 07 октября 2008 года.

Основные положения работы были доложены на заседаниях секции гнотобиологии Московского отделения Всероссийского общества эпидемиологов, микробиологов и паразитологов им. И.И. Мечникова в 2005 и 2008 гг., на практической конференции «Тимаковские чтения», проводимой секцией гнотобиологии 24.12.2002 г. в ГОУ ВПО РГМУ.

Публикации По теме диссертации опубликовано 15 научных работ, в том числе 3 статьи - в изданиях, рекомендуемых ВАК РФ, в сборниках научных трудов – 6, в других журналах 1, в материалах конференций – 5.

Объм и структура диссертации Диссертационная работа изложена на русском языке на 95 страницах машинописного текста, состоит из введения, 4 глав, выводов, практических рекомендаций и списка литературы. Библиография включает 213 источников, в том числе 33 работы отечественных авторов и 180 работ зарубежных авторов. Диссертация иллюстрирована таблицами и 4 рисунками.

СОДЕРЖАНИЕ РАБОТЫ

Материалы и методы С целью решения поставленных задач нами была проведена оценка состояния кишечной микрофлоры у 62 клинически здоровых детей обоего пола, из которых пятеро дети в возрасте от 1 до 3 дней, четверо - в возрасте от 14 до 16 дней, 12 - в возрасте от 1 до 6 месяцев и 28 - в возрасте от 8 до 16 месяцев. Все эти дети (первая группа) были рождены от здоровых матерей в срок. Семеро детей, из группы 8-16 месяцев, были повторно обследованы в возрасте 6-ти лет. Кроме того, одновременно с исследованием микрофлоры кишечника у 13 детей, возраст которых составлял от 2-х до 11 месяцев, было проведено изучение кишечной флоры и у их матерей.

Вторая группа обследуемых включала 16 недоношенных детей (гестационный возраст - 28-36 недель), родившихся от матерей с дородовым излитием околоплодных вод.

Дети находились в палате интенсивной терапии и получали антибактериальную терапию и препараты пробиотики (ампициллин, гентамицин + линекс и бифидумбактерин).

Исследование микрофлоры кишечника у детей этой группы было проведено первично в первые трое суток жизни, затем в возрасте 2-х недель, и в возрасте 1-2-х месяцев. Также было проведено изучение кишечной микрофлоры у 12 женщин с дородовым излитием околоплодных вод.

Материалом для исследования являлись фекалии. Выделение микроорганизмов проводили на следующих питательных средах: Бактофок (Гидробиос, Россия) - для бифидобактерий, MRS (Oxoid, Англия) - для лактобактерий, Columbia agar Base (BBL, США) с добавлением канамицина (100 мг/л), витамина К (1,5 мг/л) и крови (5%) - для выделения неспорообразующей облигатно-анаэробной флоры, TSN - agar (Serva, США) с добавлением эмульсии яичного желтка (50 мл/л) - для клостридий, Staphylococcus agar (Difco, США) - для стафилококков, Enterococcus agar (Serva, США) - для энтерококков, Sabouraud Dextrose agar (Serva, США) с добавлением ампиокса (100 мг/л) - для дрожжеподобных грибов рода Candida. Микроорганизмы семейства Enterobacteriaceae выделяли на среде Endo agar (Serva, США) и Brain Heart Infusion agar с добавлением 5% крови. Чашки Петри с посевами инкубировали при 37°С в течение 48 часов. Для культивирования облигатно-анаэробных микроорганизмов использовали микроанаэро статы (Оxoid,Англия), заполненные газовой смесью (85% N2, 10% С03,5%Н2) (Постникова Е.А., 2006).





Первичный скрининг штаммов бифидобактерий осуществляли на основании изучения морфологических свойств выросших колоний и окраски материала из них по Граму. Все колонии, подозрительные на принадлежность к роду бифидобактерий, были отсеяны для получения чистой культуры сначала на плотную питательную среду, а затем в жидкую питательную среду TPY для последующего приготовления лиофилизированных стоков.

Лиофилизацию чистых культур бактерий проводили в растворе сахарозы (10%) и желатина (1%) в лиофильной сушке SB1 (Chemlab, Англия). Все последующие манипуляции с чистыми культурами бифидобактерий осуществляли после их выделения из лиофилизированных стоков.

Геномную ДНК из чистых культур бифидобактерий, выделяли с использованием «Genomic DNA Purification Kit» («Fermentas», Литва) в соответствии с рекомендациями изготовителя. Качество и количество ДНК оценивали при помощи электрофореза в 1% агарозном геле.

Видовую идентификацию штаммов бифидобактерий проводили методом ПЦР с девятью парами видоспецифичных праймеров, комплементарных гену 16S рРНК (Bifidobacterium longum, B. bifidum, B. infantis, B. adolescentis генотипы А и B, B.

catenulatum, B. angulatum и B. dentum) (Matsuki T., 2003) (таблица №1). Видовую принадлежность не идентифицированных методом ПЦР штаммов определяли путем секвенирования фрагмента гена 16S рРНК. Продукты секвенирования анализировали при помощи автоматического секвенатора ABI 3100 GeneticAnalyzer («Applied Biosystems», США) и набора программного обеспечения к нему.

Для обнаружения межштаммовых геномных различий у бифидобактерий одного вида был использован метод RAPD-PCR (Bassam et al., 1992) с использованием протокола Jeff Broadbent из Университета штата Юта, США (личное сообщение). Амплификация осуществлялась с использованием амплификатора МС-2 «Терцик» (ЗАО «ДНК Технология») и следующей программы: 1) первоначальная денатурация 950С 3 мин;

2) циклов: 940С 20 сек, 580С 20 сек, 720С 30 сек;

3) финальная элонгация 720С 5 мин;

4) охлаждение до 40С.

Генотипирование бифидобактерий методом REP-ПЦР проводили с использованием праймера BOXA1R по методу Masco L. (Masco L, 2003), установленная температура отжига 520С.

Продукты ПЦР были визуализированы при помощи гель-электрофореза 10 мкл образцов в 1,5% агарозном геле, приготовленном на буфере 1Х TAE, содержащем 0, мкг/мл бромистого этидия.

Таблица № Набор олигонуклеотидных праймеров, использованных для видовой идентификации бифидобактерий с помощью ПЦР Вид Праймер Последовательность Длина Размер праймера, ПЦР пн продукта, пн B. adolescentis BiADO-1 CTCCAGTTGGATGCATGTC 19 BiADO-2 CGAAGGCTTGCTCCCAGT B. angulatum BiANG-1 CAGTCCATCGCATGGTGGT 19 BiANG-2 GAAGGCTTGCTCCCCAAC B. bifidum BiBIF-1 CCACATGATCGCATGTGATTG 21 BiBIF-2 CCGAAGGCTTGCTCCCAAA B. breve BiBRE-1 CCGGATGCTCCATCACAC 18 BiBRE-2 ACAAAGTGCCTTGCTCCCT группа BiCAT-1 CGGATGCTCCGACTCCT 17 B. catenulatum BiCAT-2 CGAAGGCTTGCTCCCGAT B. longum BiLON-1 TTCCAGTTGATCGCATGGTC 20 BiLON-2 GGGAAGCCGTATCTCTACGA B. infantis BiINF-1 TTCCAGTTGATCGCATGGTC 20 BiINF-2 GGAAACCCCATCTCTGGGAT B. dentium BiDEN-1 ATCCCGGGGGTTCGCCT 17 BiDEN-2 GAAGGGCTTGCTCCCGA Статистическую обработку полученных результатов проводили с использованием общепринятых статистических методов на IBM совместимом персональном компьютере с применением программ “Microsoft Excel” и «Biostat». Для проведения статистического анализа полученные результаты представляли в log числа микробов на 1 г исследуемого материала. Для каждой таксономической группы микроорганизмов в каждой обследуемой группе детей считали среднее значение концентрации, стандартное отклонение, частоту встречаемости. Для определения достоверности различий в количественных показателях микроорганизмов между возрастными группами использовали многофакторный дисперсионный анализ и t-критерий Стьюдента (Гланц С., 1998) РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЙ И ОБСУЖДЕНИЕ Микробиологический мониторинг интестинальной микрофлоры у детей Исследование микрофлоры кишечника здоровых детей, проведнное на третьи сутки жизни, выявило отсутствие у них облигатно анаэробных бактерий (таблица №2).

При этом у 60% детей были выявлены лактозопозитивные кишечные палочки, среднее количество которых составило 7,3±1,5 log КОЕ/г исследуемого материала. Кроме того, у 80% обследуемых детей этого возраста присутствовали стафилококки (4,9±2,3 log КОЕ/г) и энтерококки (8,1±2,0 log КОЕ/г).

Исследование кишечного содержимого у детей на 14-16 день жизни выявило, что бифидобактерии в толстой кишке определялись в 100% случаев, а их среднее количество составляло 9,1±0,5 log КОЕ/г исследуемого материала. Также у 100% детей были выявлены лактобактерии (8,2±0,9 log КОЕ/г), лактозопозитивные эшерихии (7,3±1,3 log КОЕ/г) и энтерококки (7,6±0,5 log КОЕ/г), у 50% - коагулазонегативные стафилококки (6,1±0,02 log КОЕ/г) и бактероиды (7,9±0,4 log КОЕ/г). У 28% детей этой группы в кишечнике были обнаружены лактозонегативные E.coli (6,4±1,3 log КОЕ/г).

В микробиоценозе кишечника детей в возрасте от 1 до 6 месяцев по-прежнему преобладали бифидобактерии, определявшиеся со 100% частотой, в количестве, составлявшем 10,1±0,6 log КОЕ/г. Лактобактерии выделялись у 75% детей (8,3±0,8 log КОЕ/г), бактероиды - в 50% случаев (9,8±0,9 log lg КОЕ/г). У всех детей были обнаружены типичные лактозопозитивные эшерихии и энтерококки в среднем количестве, составившем 8,5±0,9 log КОЕ/г и 8,1±1,0 log КОЕ/г исследуемого материала соответственно. Кроме того, в кишечной микрофлоре детей этой возрастной группы было выявлено разнообразие факультативно анаэробных микроорганизмов. Так, у 58% детей выделены S. аureus, количество которых достигало 5,3±1,6 log КОЕ/г, в 42% случаев были обнаружены цитробактеры (6,3±0,3 log КОЕ/г), у 58% были выделены клебсиеллы (8,3±0, log КОЕ/г) и у 17% детей определялись Enterobacter cloacae (6,4±2,8 log КОЕ/г). Грибы рода Candida были обнаружены у 42% детей в среднем количестве, составившем 3,7±1, log КОЕ/г.

Исследование микрофлоры детей в возрасте от 8 до 16 месяцев показало, что у 100% детей сохранялся высокий уровень бифидобактерий, среднее количество которых достигало 10,2±0,7 log КОЕ/г. Частота выделения лактобактерий сохранялась на уровне 79%, в среднем составляя 7,2±1,2 log КОЕ/г, а бактероидов, напротив, повысилась до 86%, при этом их уровень достигал значения 10,4±0,5 log КОЕ/г. В 93% случаев уровень Таблица № Динамика формирования кишечной микрофлоры здоровых детей 1-3 дня (n=5) 14 – 16 дней (n=4) 1-6 месяцев (n=12) 8-16 месяцев (n=29) 6 лет (n=7) Качественный состав микрофлоры Кол-во/% Mm log Кол- Кол-во/% Mm log Кол- Кол Mm log Mm log Mm log во/% во/% во/% КОЕ/г КОЕ/г КОЕ/г КОЕ/г КОЕ/г Бифидобактерии 9,1±0,5 12/100 29/100 10,2 0,7 7/ 4/100 10,10,6 9,50, Лактобактерии 8,2±0,9 9/75 23/79,3 7,21,2 3/42, 4/100 8,30,8 5,70, Бактероиды 7,9±0,4 6/50 25/86,2 10,4 0,5 7/ 2/50 9,80,9 10,10, Клостридии(H2S+/lec+) 4/33,3 15/51,7 5,1 0,75 4/57, 1/25 8,4 5,60,6 5,80, Клостридии(H2S+/lec-) 9/75 25/86,2 7,81,1 5/71, 1/25 6,6 6,91,1 6,91, Клостридии(H2S-) 1/8,3 8,6 14/48,3 9,20, Клостридии (суммарное 10/83,3 27/93,1 8,51,2 7/ 7,11,1 7,31, кол-во) Энтеробактерии: 8,8±0,5 7,7±0, 4/80 4/100 12/100 29/100 7/ 8,91,1 8,60,8 7,60, 7,3±1,5 7,3±1, E.coli(lac+/hem-) 8/66,6 27/93,1 6/85, 3/60 4/100 8,50,9 7,91,1 7,60, E.coli(lac+/hem+) 7/58,3 11/37,9 3/42, 8,51,1 8,40,75 6,60, E.coli(lac-/hem+) 1/8,3 8,7 3/10,3 7,51, 6,5±1, E.coli(lac-/hem-) 3/25 5/17,3 1/14,3 7, 1/20 9,4 3/75 7,71,3 7,20, E.coli(суммарное кол-во) 8,4±0,7 8/66,6 29/100 6/85, 8,61,1 8,40,8 7,60, K.pneumoniae 7/58,3 13/44,8 1/14,3 6, 1/20 9,4 8,50,6 6,71, K.oxytoca 4/33,3 14/48, 6,81,2 6,71, Клебсиеллы 7/58,3 22/75,8 1/14,3 6, 8,30,9 7,21, (суммарное кол-во) 1/20 9, E.cloacae 2/16,6 6/20, 6,42,8 6,641, C.freundii 5/41,6 4/13,8 1/14,3 7, 6,30,3 7,60, Прочие: P. aeruginosa 3/10,3 3,310, S. aureus 7/58,3 24/82,7 2/28, 5,31,6 4,91,3 2,80, 4,9±2,3 6,1±0, Staphylococcus spp 11/91,6 21/72,4 4/57, 4/80 2/50 5,11,4 4,11,3 4,00, 8,1±2,0 7,6±0, Enterococcus spp 12/100 27/93,1 7/ 4/80 4/100 8,10,96 7,80,8 6,10, Candida spp 5/41,6 19/65,5 3/42, 1/25 6,2 3,71,8 4,80,8 2,90, типичных эшерихий составлял 7,9±1,1 log КОЕ/г, а энтерококков - 7,8±0,8 log КОЕ/г. У 86% детей были выявлены лецитиназонегативные клостридии при среднем показателе количественного уровня 7,8±1,1 log КОЕ/г, лецитиназопозитивные клостридии были обнаружены у 52% детей при среднем показателе 5,1±0,8 log КОЕ/г. Частота выделения, клебсиелл увеличилась до 76%, коагулазопозитивных стафилококков – до 83%, грибов рода Candida - 66%.

Таким образом, микрофлора кишечника здоровых детей в возрасте от 8 до месяцев характеризуется высоким содержанием облигатно анаэробных микроорганизмов.

Наряду с бифидобактериями, у большинства детей выделяются бактероиды и лецитиназонегативные клостридии. Бифидобактерии играют существенную роль в поддержании колонизационной резистентности, на фоне избыточной колонизации кишечника условно-патогенными микроорганизмами они, возможно, препятствуют их транслокации в другие экологические ниши организма.

В шестилетнем возрасте у всех обследованных здоровых детей (100%) сохранялся высокий уровень бифидобактерий, средний показатель которых составил 9,5±0,9 log КОЕ/г. При той же частоте бактероиды выявлялись в количестве 10,1±0,4 log КОЕ/г, энтерококки - 6,1±0,6 log КОЕ/г. Однако частота выделения и количественный уровень лактобактерий снизились, причем снижение второго показателя носило достоверный характер (p0.05). Частота выявления лецитиназопозитивных клостридий сохранялась в тех же пределах (57%), а их количественный уровень несколько снизился (5,8±0,8 КОЕ/г).

При этом отмечено снижение как частоты выделения лецитиназонегативных клостридий (71%), так и количественного показателя их уровня (6,9±1,9 log КОЕ/г). На фоне высокой концентрации бифидофлоры выявлено разнообразие энтеробактерий: у 86% детей определялись типичные эшерихии (7,9±1,1 log КОЕ/г), у 43% - гемолитические эшерихии (6,6±0,5 log КОЕ/г), у 57% - лактозонегативные гемолитические эшерихии (6,8±0,6 log КОЕ/г). Стафилококки, средний показатель которых составил 4,0±0,5 log КОЕ/г, выявлены у 57% детей, у 29% из них обнаружены S. aureus (2,8±0,1 log КОЕ/г). В 43% случаев были выявлены грибы рода Candida (2,9±0,8 log КОЕ/г).

Таким образом, необходимо отметить, что достаточно высокие количественные показатели бифидофлоры сохранялись у здоровых детей при неизменно высокой частоте встречаемости (100%). Однако доминирующее положение в микробиоценозе кишечника большинства детей в возрасте от 8 месяцев и старше стали занимать облигатно анаэробные грамотрицательные бактерии рода Bacteroides.

Частота встречаемости лактобактерий у детей различных возрастных групп значительно варьировала: от 100% у детей в возрасте 14 дней до 43% у детей 6 лет.

Количественный уровень лактобактерий в этот временной период также снижался от КОЕ/г до 106 КОЕ/г.

Качественно-количественное разнообразие энтеробактерий достигало максимума к 1-6 месяцам. Типичные эшерихии доминировали среди энтеробактерий у большинства детей в течение всех периодов наблюдения. Частота встречаемости лактозонегативных E.coli у детей в возрасте 14-16 дней составляла 75%, и в последующем снижалась до 28% у детей в возрасте 1-6 месяцев, и 17% у детей 8-16 месяцев. Частота встречаемости клебсиелл к 8-16 месяцу возрастала до 76%, но в последующем к 6-ти годам снижалась до 14%.

Вторая группа обследуемых состояла из 16 недоношенных детей, родившихся от матерей с дородовым излитием околоплодных вод. Дети с рождения находились в стационаре, где получали необходимую терапию, включая антимикробную, а также биотерапевтические препараты («Бифидумбактерин» и «Линекс»). Дети находились на искусственном вскармливании.

Исследование микрофлоры кишечника недоношенных новорожденных показало, что на 3 день, на фоне полного отсутствия облигатно анаэробных бактерий, у половины детей микробный состав кишечника был представлен лактозопозитивными штаммами эшерихий. Кроме того, у небольшой части детей этой группы в кишечнике определялась грамположительная кокковая флора, включавшая стафилококки и стрептококки (таблица №3).

Особенности микробного пейзажа у данной группы детей, вероятно, обусловлены применением с момента рождения антибактериальных препаратов широкого спектра действия.

На 14-16 день доминирующими микроорганизмами оставались энтеробактерии. Так, в 88% случаях у детей высевались типичные эшерихии, в 19% - лактозонегативные эшерихии и в 25% - энтеробактеры. У 75% детей высевались энтерококки (7,8±1,2 log КОЕ/г), а у 25% - другие стрептококки. В 13% случаев были выявлены грибы рода Candida, средний показатель количества которых составил 6,4±0,8 log КОЕ/г, таким образом, значительно превышая норму. Количество бифидобактерий было снижено, и они обнаруживались только у 56% детей этого возраста. Лактобактерии были выделены у 38% детей, бактероиды - у 44%. Микробная флора 56% детей была представлена высоким уровнем анаэробных кокков – 8,2±1,0 КОЕ/г. У 31% детей выделены log негемолитические стафилококки (5,87±0,87 log КОЕ/г) и бациллы (6,78±0,97 log КОЕ/г).

В интестинальной флоре недоношенных детей в возрасте 1-2 месяцев выявлено нарастание уровня бифидобактерий до 9,2±0,7 log КОЕ/г у 60% детей и лактобактерий до Таблица № Динамика формирования кишечной микрофлоры у недоношенных детей 1-3 день(n=16) 14 дней(n=16) 1-2 мес. (n=10) Mm log Кол-во/ % Mm log Кол-во/ % Mm log Кол-во/ % Качественный КОЕ/г КОЕ/г КОЕ/г состав микрофлоры Бифидобактерии 9,2±0,7 6/ Лактобактерии 7,9±1, 5,1±1,0 6/38 10/ Бактероиды 7,2±1,5 7,9±1, 5/31 3/ Clostridium lec+ 4,0 1/ Clostridium lec- 5,5±0,2 2/ Пептококки 8,2±1,0 8,5±0, 9/56 6/ 6,6±3,0 7,5±1, E.coli lac+ hly- 7/47 8,7±0,8 14/88 8/ E.coli lac+ hly+ 8,2 1/ 9,0±1,2 7,4±0, E.coli lac- hly- 3/19 3/ 7,7±1, Klebsiella spp 6,2±1,3 4/25 5/ Klebsiella oxytoca 7,8 1/ 9,6±0, Enterobacter cloacae 3/ Proteus vulgaris 6,0 1/ Acinetobacter sp 5,7 1/ Staphylococcus 2,3±0,01 6,0±1, epidermidis 4/27 5,9±0,9 5/31 6/ 2,6±0, Staphylococcus aureus 2/ Стрептококки 3,8±1,1 7,5±0, 3/20 4/25 8,5 1/ 5,9±3,8 7,3±1, E.faecium 2/13 7,8±1,2 12/75 10/ 6,8±0, Bacillus sp 5/31 7,9 1/ 5,4±1, Candida sp 6,4±0,8 2/13 2/ 7,9±1,3 log КОЕ/г у 100%. Средний уровень бактероидов составил 7,9±1,1 log КОЕ/г, также сохранился высокий количественный уровень пептококков равный 8,5±0,6 log КОЕ/г, обнаруженных у 60% детей. Клебсиеллы были выделены у 50% детей (7,7±1,1 log КОЕ/г). Типичные эшерихии выявлены у 80% детей КОЕ/г), (7,5±1,0 log негемолитические лактозонегативные эшерихии (7,4±0,7 log КОЕ/г) – у 30%, гемолитические - у одного ребнка (8,2 log КОЕ/г). У всех детей обнаружены энтерококки в количестве 7,3±1,0 log КОЕ/г. В 20% случаев были высеяны грибы рода Candida.

Таким образом, проведнное исследование показало, что у недоношенных детей назначение антимикробных препаратов широкого спектра действия приводит к процессу патологической колонизации кишечника, выраженному дефициту бифидофлоры, избыточному увеличению уровня энтерококков и стафилококков и в целом нарушению формирования индигенной анаэробной флоры.

Исследование интестинальной микрофлоры матерей Исследование микрофлоры кишечника проводили у 26 здоровых женщин (возраст от 19 до 42 лет). Было показано (таблица №4), что доминирующей группой у них являлись бифидобактерии, определявшиеся со 100% частотой, в среднем количестве, составившем 9,0±0,4 log КОЕ/г исследуемого материала. У 92% женщин выявлялись лактобактерии и бактероиды. Другие группы строго анаэробных бактерий определялись с меньшей частотой. У 100% женщин выявлялись типичные эшерихии. Лактозонегативные кишечные палочки были обнаружены в одном случае (7,4 lg log КОЕ/г), клебсиеллы у 8% женщин (6,4±0,01 log КОЕ/г). У всех обследованных выявлены энтерококки в количестве 6,9±0,13 log КОЕ/г. Staphylococcus aureus (5,6±1,8 log КОЕ/г) у 15%, коагулазонегативные стафилококки - у 50% (4,3±0,5 log КОЕ/г). У 46% женщин выявлены грибы рода Candida при среднем показателе 4,1±0,5 log КОЕ/г, у одной женщины – филаментозные грибы в количестве 2,3 log КОЕ/г. Кроме этого у 12% обследуемых были выявлены аэробные спорообразующие бациллы (5,1±2,0 log КОЕ/г). Таким образом, полученные результаты свидетельствуют о высоком уровне и частоте обнаружения бифидобактерий у всех обследованных женщин.

Таблица № Сравнительная характеристика интестинальной микрофлоры у здоровых женщин и женщин с дородовым излитием здоровые жен. (n=26) жен. с дород. изл (n=12) Качественный состав Mm log Mm log КОЕ/г количество/% КОЕ/г количество/% микрофлоры Бифидобактерии 9,0±0,4 8,4±0, 26/100 12/ Лактобактерии 6,4±0,9 7,5±0, 24/92 10/ Бактероиды 8,9±0,9 8,8±1, 24/92 9/ 5,2±0, Clostridium lec+ 3/ 7,7±0, Clostridium lec- 11/42 8,7 1/ Пептококки 7,3±0,8 8,1±0, 7/27 4/ 7,1±0,9 8,3±0, E.coli lac+ hly- 26/100 11/ 7,1±0, E.coli lac+ hly+ 4/ 6,4±1, E.coli lac- hly- 7,4 1/4 3/ 6,5±0, Klebsiella spp 2/ 4,4±0,6 6,0±0, Staphylococcus spp 13/50 6/ 5,7±1, Staphylococcus aureus 4/ 6,9±0,1 6,5±0, Streptococcus faecalis 26/100 9/ 5,1±2, Bacillus spp 3/ 4,2±0,6 6,9±0, Candida spp 12/46 3/ Достоверных отличий в частоте обнаружения определяемых кишечных микроорганизмов у женщин с дородовым излитием по сравнению со здоровыми женщинами обнаружено не было. Однако у женщин этой группы наблюдалось достоверное снижение количества бифидобактерий и напротив статистически значимое увеличение количества эшерихий, стафилококков и дрожжеподобных грибов рода Candida (p0,05).

Сравнительный анализ видового состава бифидобактерий у людей различного возраста.

Результаты исследования видового состава кишечной бифидофлоры у здоровых детей и женщин различного возраста представлены в таблице №5. В результате проведенного исследования было установлено, что частота обнаружения бифидобактерий вида B.longum в интестинальной микрофлоре грудных детей составляла 50% и была статистически значимо ниже (р 0,05), по сравнению с частотой их обнаружения у людей остальных возрастных групп. Однако количество бифидобактерий этого вида у детей раннего возраста была достоверно выше по сравнению с детьми младшего возраста и со взрослыми (р 0,05). B.bifidum с высокой частотой встречались у людей всех возрастных групп, но наибольшей частота их встречаемости была у грудных детей (66,6%). И хотя имело место снижение частоты встречаемости бифидобактерий этого вида с увеличением возраста человека, статистически оно не было значимо. Концентрация B.bifidum находилась в пределах 109 КОЕ/г и статистически значимо в группах не отличалась.

B.breve были обнаружены только у детей раннего возраста в высокой концентрации, превысившей 109 КОЕ/г исследуемого материала,. У детей в возрасте 6 лет бактерии этого вида обнаружены не были, а в группе взрослых людей B.breve были обнаружены только в одном случае в концентрации, не превысившей 108 КОЕ/г исследуемого материала.

Наоборот частота встречаемости бифидобактерий вида B.catenulatum имела тенденцию к росту с увеличением возраста. Так, у грудных детей данный вид бифидобактерий обнаружен не был. В дальнейшем у детей в возрасте от 8 до 16 месяцев и у детей 6 лет бактерии этого вида были обнаружены с частотой 20,7% и 57% соответственно. У взрослых частота обнаружений B.catenulatum составила 31%. Среднее значение концентрации бифидобактерий этого вида у детей раннего возраста была статистически значимо выше (р 0,05), чем у детей 6-ти лет и у взрослых. Частота встречаемости B.adolescentis у детей раннего возраста была статистически значимо ниже, чем у детей 6 ти летнего возраста и у взрослых (р0,05). Вид B.longum bv. infantis встречался только у детей 1-6 месяцев с частотой равной 33,3%. B.dentium c низкой частотой были обнаружены только у детей раннего возраста. Также с низкой частотой, но в концентрации превышавшей 109 КОЕ/г исследуемого материала у детей в возрасте 1- месяцев и 6-ти лет, в испражнениях были обнаружены бифидобактерии вида B.angulatum, а у детей в возрасте 8-16 месяцев - B.animalis.

Таким образом, в наших исследованиях по изучению видового состава кишечных бифидобактерий у здоровых детей и женщин различного возраста было выявлено, что у детей раннего возраста доминирующими таксонами являются бифидобактерии видов B.

bifidum, B. longum и B.breve. Кроме того, у детей в возрасте от 1 до 6 месяцев к этой группе относятся и бифидобактрии B.longum bv. infantis. У детей в возрасте 6 лет и у взрослых бифидофлора в основном была представлена видами B. longum, B. adolescentis, B. catenulatum и B. bifidum. Частота встречаемости других видов бифидобактерий заметно уступала этим доминирующим видам.

Таблица № Результаты качественного и количественного состава бифидобактерий у здоровых детей и женщин различного возраста Низкие значения частоты обнаружения у группы детей 8-16 месяцев B. adolescentis, в совокупности с небольшой частотой выявления бифидобактерий группы B. catenulatum, 1-6 месяцев (n=12) 8-16 месяцев (n=29) 6 лет (n=7) 19-42 года (n=13) Качественный состав Mm log Кол- Mm log Кол- Mm log Кол- Mm log Кол бифидофлоры во/% во/% во/% во/% КОЕ/г КОЕ/г КОЕ/г КОЕ/г B.bifidum 8/66,6 9,60,75 14/48,3 9,20,05 3/42,8 6/ 9,60,7 8,90, B.longum 6/50 23/79,3 7/100 12/92, 9,70,8 9,80,7 8,90,7 8,50, B.breve 2/16,6 5/17,3 8,6 1/7, 9,50,9 9,71, B.catenulatum 10,10,5 6/20,7 4/57,1 4/30, 9,20,6 8,80, B.adolescentis 2/16,6 10,10,3 4/13,8 5/71,4 10/76, 9,81,2 9,11,7 9,40, B.longum bv. 4/33, 9,70, infantis B.dentium 8,3 1/8,3 2/6, 9,70, B.angulatum 9,75 1/8,3 9,9 1/14, B.animalis 4/13, 9,80, указывает на то, что и к 16 месяцу жизни процесс реколонизации кишечника новыми видами бифидобактерий в основном не завершен и, таким образом, интестинальный микробиоценоз продолжает оставаться в состоянии динамического развития, отличаясь от микрофлоры детей более старшего возраста и взрослых людей, характеризующейся стабильностью.

Сравнительный анализ штаммов бифидобактерий кишечной микрофлоры матерей и детей грудного возраста при помощи молекулярно-генетических методов Изучение качественного и количественного состава кишечной бифидофлоры проводили в группе включавшей 13 пар мать-ребенок. Возраст двух обследованных детей составлял 11 и 9 месяцев, возраст остальных детей варьировал от 2 до 5,5 месяцев и в среднем составил 3,2 месяца. Возраст двух матерей составлял 19 и 42 года, возраст остальных варьировал от 24 до 30 лет и в среднем составил 26,2 года. Все дети и матери на момент обследования были клинически здоровы и не имели в анамнезе инфекционных заболеваний желудочно-кишечного тракта. Дети с момента рождения находились на грудном вскармливании.

Видовую идентификацию штаммов бифидобактерий проводили методом ПЦР с девятью парами видоспецифичных праймеров. Видовую принадлежность не идентифицированных методом ПЦР штаммов определяли путем секвенирования фрагмента гена 16S рРНК. Генотипирование бифидобактерий - методом REP-ПЦР.

В результате первичного скрининга от 13 пар мать-ребенок было получено изолята бифидобактерий (61 и 43 от матерей и детей соответственно). Частота встречаемости бифидобактерий составила 100% в обеих группах. Среднее количество бифидобактерий у обследуемых детей составило 10,20,6 logКОЕ/г исследуемого материала, у матерей 9,40,6 logКОЕ/г. Для изучения видового состава выделенных штаммов был использован описанный выше подход. Каждый штамм тестировали с девятью парами видоспецифичных праймеров. Этот метод позволил идентифицировать большинство штаммов. ДНК из 12 штаммов не дали положительных реакций ни с одной парой праймеров. Для трх из них видовая принадлежность была установлена путем частичного секвенирования 16S рДНК. Для 9 изолятов бифидобактерий видовая принадлежность осталась не установленной. Среднее количество видов бифидобактерий в одном образце, с учетом выбранного уровня разрешения, составило 2,71,1 у матерей и 1,91,0 у детей.

Таким образом, из 104 изолятов были успешно идентифицированы 95, из которых 17 относились к виду B. longum, 29 - B. adolescentis, 4 - B. catenulatum, 7 - B. bifidum и 1 B. breve у матерей и 13 - к виду B. longum, 13 - B. bifidum, 4 - B. longum bv. infantis, 2 - B.

breve, 1 - B. angulatum, 2 - B. adolescentis и 2 - B. dentium у детей. Встречаемость различных видов бифидобактерий в группе матерей была следующей: наиболее часто встречающимися оказались виды B. longum и B. adolescentis, определявшиеся с частотой 92,3% и 76,9% соответственно, виды B. bifidum, B. catenulatum и B. breve встречались реже, с частотой 46,2%, 30,8% и 7,7% соответственно. В группе детей распределение видов бифидобактерий оказалось иным. Наиболее часто встречающимися видами были B.

bifidum и B. longum, определявшиеся с частотой 61,5% и 53,8% соответственно. Реже встречались B. longum bv. infantis и B. breve с частотой встречаемости 30,7% и 15,4% соответственно. B. adolescentis и B. dentium выявлялись с одинаковой частотой составившей 15,4%. Реже других обнаруживался вид B. angulatum, частота встречаемости которого составила 7,7%. Определение видовой принадлежности выделенных бифидобактерий выявило, что некоторые из обследуемых были источниками двух или большего количества изолятов одного вида.

У 9 (из 13) пар мать-ребенок были выявлены совпадающие по видовой принадлежности штаммы бифидобактерий (всего 34 штамма). Видами, которые встречались и в группе матерей и в группе детей были B. longum в шести парах мать ребенок, B. bifidum - в четырех парах, B. adolescentis и B. breve - в одной паре. Для того чтобы установить, являются ли данные штаммы матерей и детей генетически идентичными, был использован метод REP-ПЦР. В тех случаях, когда REP-ПЦР профили изучаемых бифидобактерий, выделенных от матери и ребенка, имели 100% идентичность по числу, а также массе электрофоретических полос, они, рассматривались, как принадлежащие одному штамму соответствующего вида бактерий, и, наоборот, когда продукты ПЦР при их электрофоретическом разделении давали различные профили полос, изоляты рассматривали как различные штаммы одного вида бифидобактерий (рисунок №1). В результате исследования было выявлено, что у пяти пар мать-ребенок (38,5%) в кишечнике присутствуют идентичные штаммы бифидобактерий. В трех случаях идентичные штаммы бифидобактерий относились к виду B. bifidum, в одном случае - к виду B. longum, и в одном случае - к виду B. adolescentis. Причем в четырех случаях возраст детей колонизированных бифидобактериями, генетически идентичными материнским штаммам, варьировал от 2 до 5,5 месяцев, а в одном случае составил месяцев. Таким образом, более трети детей были колонизированы кишечными штаммами бифидобактерий генетически идентичными штаммам выделенных от их матери.

Полученные нами результаты свидетельствуют в пользу существующей гипотезы об участии материнских штаммов бифидобактерий в ранней колонизации кишечника детей.

С другой стороны, у большей части детей в составе микрофлоры, бифидобактерий, генетически идентичных материнским штаммам обнаружено не было и источник их происхождения остался неизвестен. Это может быть связано с тем, что настоящее исследование было сосредоточено на сравнительном анализе в кишечнике у матерей и их детей только доминирующих штаммов бифидобактерий, концентрация которых составляла не менее 108 КОЕ/г исследуемого материала, в то время как популяции бактерий, колонизирующих кишечник в более низких концентрациях, не учитывались.

Кроме того, как уже было отмечено выше, источником первичной колонизации кишечника ребенка бактериями, являются родовые пути матери, в состав микрофлоры которых наряду с доминирующими в этой экологической нише лактобациллами входят и бифидобактерии.

Рисунок №1. Гель-электрофорез продуктов REP-ПЦР геномной ДНК штаммов бифидобактерий, выделенных из испражнений у пар мать-ребенок.

Примечание: звездочками обозначены идентичные профили электрофоретических полос продуктов REP-ПЦР ДНК детских (Р) и материнских (М) штаммов.

A. Пара №1, штаммы B.longum. 1 - М7;

2 - Р22;

3 - Р29;

4 - М1;

5 - Р18;

6 - М3;

7 Р23;

8 - Р19;

9 - Р25.

Б. Пара №9, штаммы B. bifidum. 1 - М11;

2 - М15;

3 - Р2. Пара №9, штаммы B.longum. 4 - М13;

5 - Р1. Пара №10, штаммы B.bifidum. 6 - М2;

7 - Р8. Пара №12, штаммы B.adolescentis. 8 - М2;

9 - Р11.

В. 1 - пара №1, штамм B. longum Р17;

2 - пара №8, штамм B.bifidum Р.;

3 - пара №10, штамм B.longum М:. Пара №13, штаммы B. bifidum. 4 - М5;

5 - Р2. Пара №13, штаммы B.breve. 6 - Р4;

7 - Р1.

В совокупности полученные результаты свидетельствуют о том, что последующие исследования в этом направлении должны быть проведены не только путем сравнения штаммов, доминирующих в кишечнике, но и минорных групп бифидобактерий, а также с привлечением большего количества потенциальных источников колонизации детей бактериями нормальной микрофлоры.

Изучение штаммового разнообразия в популяции бифидобактерий кишечной микрофлоры детей раннего возраста при помощи молекулярно-генетических методов исследований Изучение параметров состава бифидобактерий проводили у 29 детей обоего пола ( мальчиков и 17 девочек), проживающих в ЮЗАО г. Москвы. Возраст детей варьировал от 8 до 16 месяцев и в среднем составил 11 месяцев.

В результате первичного скрининга чашек с посевами испражнений от 29 детей было получено 84 изолята бифидобактерий. Частота встречаемости бифидобактерий с учетом избранного уровня их выявления составила 100%. Среднее количество бифидобактерий у обследуемых детей составило 10,2±0,7 log КОЕ/г исследуемого материала. Видовой состав бифидобактерий этих детей обсуждался в предыдущем разделе и представлен в таблице № 5.

Определение видовой принадлежности бифидобактерий, выделенных от детей, выявило, что некоторые из них были источниками двух или большего количества изолятов одного вида. Для выявления возможного субвидового отличия бактерий мы осуществили типирование выделенных изолятов при помощи метода RAPD-ПЦР. Данный метод зарекомендовал себя в качестве быстрого и надежного средства для межштаммовой дифференцировки прокариот, в том числе и молочнокислых бактерий. RAPD-ПЦР профили, которые были получены путем амплификации бактериальных ДНК с использованием избранного праймера, позволил получить большую базу данных в виде наборов различных по числу и массе электрофоретических полос, характеризующих изучаемые изоляты (рисунок №2). В тех случаях, когда RAPD-ПЦР профили тестируемых бифидобактерий, выделенных от одного ребенка, имели 100% идентичность по числу и массе полос они рассматривались нами, как принадлежащие одному штамму.

На основании данных видовой идентификации бактерий и анализа профилей RAPD изучаемых штаммов, в совокупности с данными изучения культуральных и морфологических свойств изолятов бифидобактерий, был определен качественный состав бифидобактерий у обследованных детей. Доминирующими видами бифидобактерий в кишечной микрофлоре детей оказались виды B. longum (79,3%) и B. bifidum (48,3%). При использованном уровне количественной детекции, кроме того, изредка определялись бактерии группы B. catenulatum (20,7%) и B.breve (17,3%). Ни в одном случае не было обнаружено бифидобактерий видов B.longum bv. infantis и B. angulatum. Среднее число видов, выявленных у одного ребенка, составило 1,6±0,15, в то время как среднее число штаммов, на один образец было статистически значимо выше и составило 2,3±0, (p=0,02).

Рисунок №2. Образцы электрофоретических профилей RAPD-ПЦР, характерных для изученных штаммов бифидобактерий.

Примечание: B, C – профили бифидобактерий, под каждым RAPD-ПЦР профилем указан соответствующий вид бифидобактерий и шифр ребенка. Линиями сверху объединены схожие профили. А - Для сравнения приведены профили лактобацилл, выделенных от детей. РЖ - ребенок женского пола. РМ - ребенок мужского пола.

Таким образом, среднее количество колонизирующих кишечник предоминантных штаммов бифидобактерий статистически значимо превышает количество видов этого рода. Полученные данные свидетельствуют о высоком субвидовом разнообразии бактерий, представителей мутуалистической части микрофлоры кишечника, что может иметь значение для поддержания их стабильно высокого популяционного уровня в меняющихся условиях среды и оптимального выполнения ими своих биологических функций.

Изменения в видовом и штаммовом составе бифидобактерий у детей через пятилетний период (в возрасте шести лет) При повторном исследовании 7 детей из предыдущей группы, проведенном через лет, от них было выделено 35 доминантных штаммов бифидобактерий. Видовой состав бифидобактерий, определенный путем ПЦР с видоспецифичными бифидобактериальными праймерами или путем анализа частично секвенированной последовательности гена 16S рРНК, представлен в таблице № 5. Среднее количество видов бифидобактерий в одном образце составило 2,850,34.

В ходе нашей работы было выделено всего 23 штамма различных видов бифидобактерий, преимущественно B. longum, которые встречались у одних и тех же детей, как при первичном, так и при вторичном исследовании. Для того чтобы установить, являются ли данные штаммы генетически идентичными, был применен метод REP-ПЦР фингерпринтинга. Было обнаружено, что в большинстве случаев произошла смена доминантных штаммов. Только две пары штаммов, выделенные в различные временные периоды от двух детей, были неотличимы друг от друга согласно их геномным отпечаткам (рисунок №3). По нашим данным, это является первым сообщением о длительной персистенции штаммов бифидобактерий в кишечнике человека и свидетельствует о целесообразности дальнейшего изучения на большей выборке и с применением более детального анализа.

Ребенок 1 Ребенок 2 Ребенок 6 6 6 1 6 1 6 6 1 Рисунок №3. Сравнение доминирующих штаммов B.longum,выделенных от одних и тех же детей в возрасте 1 года и 6 лет.

Примечание: REP-ПЦР профили, цифра указывает возраст детей. Идентичные штаммы выделены прямоугольниками.

Выводы.

Микробиоценоз толстого кишечника клинически здоровых детей раннего 1.

возраста характеризуется высоким уровнем содержания бифидобактерий, превышающим значение 1010 КОЕ/г исследуемого материала, и, наряду с этим, присутствием условно-патогенных микроорганизмов, в т. ч. клебсиелл, золотистых стафилококков, лецитиназопозитивных клостридий и дрожжеподобных грибов рода Candida.

У недоношенных новорожденных на фоне лечения антибактериальными 2.

препаратами процесс колонизации кишечника бифидофлорой замедляется, а преобладающими микроорганизмами являются энтеробактерии, энтерококки и стафилококки.

Идентификация бифидобактерий, проведенная с использованием ПЦР с 3.

видоспецифичными праймерами и путем частичного секвенирования 16S рДНК, показала, что в ранние периоды физиологической адаптации для микрофлоры кишечника детей характерны высокие популяционные уровни и частота выделения бифидобактерий видов B. bifidum, B. longum и B. breve. Кроме того, в первые шесть месяцев после рождения выявляются бифидобактрии B.longum bv.

infantis. У детей в возрасте 6 лет и у взрослых людей бифидофлора, в основном, представлена видами B. longum, B. adolescentis, B. catenulatum и B. bifidum.

4. В составе кишечной микрофлоры более трети детей (38,5% случаев) содержатся штаммы бифидобактерий, генетически идентичные материнским штаммам. Эти результаты свидетельствуют об участии материнских штаммов бифидобактерий в ранней колонизации кишечника детей.

5. Обнаружение генетически идентичных штаммов бифидобактерий, относящихся к виду B. longum, в микрофлоре кишечника у детей при повторном исследовании, проведенном спустя 5 лет после первичного исследования, свидетельствуют о том, что бифидобактерии этого вида могут длительно колонизировать кишечник индивидуального хозяина.

Практические рекомендации Полученные данные о формировании кишечной микрофлоры у детей свидетельствуют о необходимости внедрения в педиатрическую практику методов генотипирования для определения видового и штаммового состава бифидобактерий.

При этом идентификация бифидобактерий может быть осуществлена с использованием ПЦР и видоспецифических бифидобактериальных праймеров быстро, прецизионно, обеспечивая экономичность исследования.

Обнаружение в кишечнике детей раннего возраста штаммов бифидобактерий, идентичных материнским, а также способности штаммов некоторых видов бифидобактерий длительное время доминировать в кишечнике людей, позволяет в будущем развивать научно-практическое направление исследований, целью которого должно стать изучение возможности создания и применения пробиотических препаратов. Пробиотические препараты, приготовленные на основе донорских материнских штаммов, а также аутоштаммов бифидобактерий, могут использоваться для коррекции дисбиотических нарушений микрофлоры кишечника у детей, вызванных продолжительной антибиотикотерапией.

Список опубликованных работ:

1. Лянная А.М. Биологические и экологические особенности микробов рода Bifidobacterium / Лянная А.М., Интизаров М.М., Донских Е.Е. // сб. МИИЭМ – М., 1986.- С. 32-38.

2. Гончарова Г.И. Бифидофлора человека, е нормализующие и защитные функции /Гончарова Г.И., Семенова Л.П., Лянная А.М., Козлова Э.П., Донских Е.Е. // Антибиотики и медбиотехнология. – М., - 1987. - Т.XXXII - C.179-183.

3. Донских Е.Е. Кислотообразующая активность бифидобактерий. // Сб.2-го МОЛГМИ – М., - 1987. - C. 63.

4. Донских Е.Е. Качественный и количественный состав кислот, образуемых бифидобактериями. / Донских Е.Е., Гончарова Г.И. // Журнал микробиологии, эпидемиологии и иммунобиологии. – М., – 1987. - №7, C. 11-15.

5. Гончарова Г.И. Количественный уровень бифидофлоры в кишечнике и его коррелятивная связь с состоянием здоровья человека. / Гончарова Г.И., Лянная А.М., Семенова Л.П., Донских Е.Е. // Труды МНИИЭМ. – М., - 1988. - C. 118-124.

6. Козлова Э.П. Клинико-микробиологическая оценка эффективности сухих и жидких бифидосодержащих продуктов при искусственном вскармливании у детей. / Козлова Э.П., Груздева Т.А., Кулеш Е.М., Донских Е.Е. // Вопросы детской гастроэнтерологии. - М., - 1988. - № 5, C. 106-117.

7. Тюрин М.В. Выделение плазмидной ДНК из бифидобактерий. / Тюрин М.В., Донских Е.Е., Гончарова Г.И., Шендеров Б.А. // Антибиотики и химиотерапия. – М., - 1990.- №7 - C. 23-25.

8. Гончарова Г.И. Характеристика и использование бифидобактерий, выделенных от взрослых и детей. / Гончарова Г.И., Лянная А.М., Бевз Н.И., Груздева Т.А., Донских Е.Е. // Сб. МНИИЭМ. М., - 1990. - C. 48-53.

9. Гончарова Г.И. Защитная роль бифидофлоры в организме новорожденных. / Гончарова Г.И., Чистякова В.И., Лянная А.М., Донских Е.Е., Бевз Н.И., Козлова Э.П. // Сб. МНИИЭМ. – М., - 1991. - С. 10. Ефимов Б.А. Микрофлора кишечника у населения разных стран. / Ефимов Б.А., Коршунов В.М., Кафарская Л.И., Пикина А.П., Донских Е.Е. // Тезисы докладов Всероссийской научно-практической конференции «Дисбактериозы и эубиотики». - М.

1996. - С. 12.

11. Ефимов Б.А. Влияние микробной контаминации окружающей среды на колонизацию кишечника детей раннего возраста. / Ефимов Б.А., Кафарская Л.И., Донских Е.Е. // Материалы конференции для специалистов ЦФО: «Эпидемиология, диагностика, профилактика и лечение актуальных инфекционных заболеваний» - М., - 19-20 октября, 2004. - С. 34-36.

12. Ван Ликуй. Молекулярный мониторинг микрофлоры кишечника недоношенных новорожденных. / Ван Ликуй, Кафарская Л.И., Шкопоров А.Н., Донских Е.Е // В материалах IV конгресса педиатров-инфекционистов России «Актуальные вопросы инфекционной патологии у детей». - М., - 14-16 декабря, 2005. - С. 13. Кафарская Л.И. Локальный иммунитет кишечника. / Кафарская Л.И., Володин Н.Н., Ефимов Б.А., Донских Е.Е., Шкопоров А.Н. // Вопросы практической педиатрии. - 2007. - Т.2 - № 4 - С. 46-50.

14. Goncharova G.I. Characteristic of Bifidobacterium isolated from feces of infant adults. / Goncharova G.I., Ljannaja A.M., Donskikh E.E. // Abstracts. 10th International Bifidobacterium Conference. – Tokyo, Japan. – Sept. 12-13, 1990. - P. 15. Kulagina E.V. Comparative study of species and strain distribution of bifidobacteria in the breast-fed infants and thier mothers /Kulagina E.V., Shkoporov A.N., Donskikh E.E., Khokhlova E.V., Kafarskaya L.I., Efimov B.A. //

Abstract

book The 9th Biennial Congress of the Anaerobe Society of the Americans. - Long Beach, California USA, - June 24-27, 2008. - P. 27.

Список сокращений:

1. КОЕ – колониеобразующая единица 2. ПЦР – полимеразно-цепная реакция 3. M – среднее значение величин 4. m – стандартное отклонение от средней величины 5. n – количество образцов 6. REP-ПЦР - амплификация повторяющихся элементов геномной ДНК 7. RAPD-ПЦР - случайно амплифицированные полиморфные ДНК 8. (H2S+/lec+) – сероводородпродуцирующие, лецитиназопозитивные 9. (H2S+/lec-) - сероводородпродуцирующие, лецитиназонегативные 10. (lac+/hem+) – лактозопозитивные, гемолизин продуцирующие 11. (lac+/hem-) - лактозопозитивные, гемолизин не продуцирующие 12. (lac-/hem-) - лактозонегативные, гемолизин не продуцирующие 13. (lac-/hem+) - лактозонегативные, гемолизин продуцирующие

 

Похожие работы:





 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.