авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Астрологический Прогноз на год: карьера, финансы, личная жизнь


Видовая идентификация микобактерий методами пцр-рестрикционного анализа

На правах рукописи

Краснова Мария Александровна

ВИДОВАЯ ИДЕНТИФИКАЦИЯ МИКОБАКТЕРИЙ

МЕТОДАМИ ПЦР-РЕСТРИКЦИОННОГО АНАЛИЗА

03.00.07 – Микробиология

Автореферат

Диссертации на соискание ученой степени

кандидата медицинских наук

Москва

2007

Работа выполнена в Московском городском научно-практическом центре борьбы

с туберкулезом Департамента здравоохранения города Москвы Научные руководители:

Доктор медицинских наук, профессор Мороз Аркадий Максович Доктор биологических наук Скотникова Ольга Ивановна

Официальные оппоненты:

Доктор медицинских наук, профессор Зубков Михаил Николаевич Доктор биологических наук, Черноусова Лариса Николаевна

Ведущая организация: ГОУ ВПО Московская медицинская академия им. И.М. Сеченова Росздрава

Защита состоится «» «» 2007г. в часов на заседании диссертационного совета Д208.046.01 при Федеральном Государственном учреждении науки «Московский научно-исследовательский институт эпидемиологии и микробиологии им. Г.Н.

Габричевского» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (125 212, Москва, ул. Адмирала Макарова, д. 10)

С диссертацией можно ознакомиться в библиотеке ФГУН «Московский научно исследовательский институт эпидемиологии и микробиологии им. Г.Н. Габричевского»

Автореферат разослан «» «_» 2007г.

Ученый секретарь Диссертационного совета кандидат биологических наук С.Ю. Комбарова

Общая характеристика работы

Актуальность проблемы Род Mycobacterium состоит из нескольких групп кислотоустойчивых микобактерий, среди которых встречаются патогенные для человека и животных.

Кроме безусловных патогенов человека, таких как M. leprae и Mycobacterium tuberculosis complex, куда входят M. tuberculosis (МБТ), M. bovis, M. bovis BCG, M.

microti, M. africanum, существует целый ряд условно-патогенных нетуберкулезных микобактерий (НТМБ), в частности относящихся к комплексу MAIS (M. avium, M.

intracellulare, M. scrofulaceum), которые могут вызвать микобактериозы, определяемые как «болезнь компрометированного хозяина».

У детей после вакцинации БЦЖ может развиться локальная или генерализованная БЦЖ-инфекция. В результате заражения M. bovis, не только у животных, но и у людей, развивается процесс, который приблизительно в 6% случаев заканчивается летальным исходом [Vordermeier H. et al., 2000;

Bahri I. et al., 2001].

Во всём мире отмечается рост заболеваемости микобактериозами. В Японии в 1998 г. заболеваемость составляла 2,3/100000 населения в год, а в странах Северной Америки и Европы колеблется от 1 до 15 на 100000 жителей [Masakazu A., 1998;

Marras T., Daley C., 2002]. Наиболее часто встречавшиеся в 1981 – 2001гг. как в Японии, так и в Северо-Западном регионе Российской Федерации микобактериозы были вызваны M. avium и M. intracellulare [Оттен Т.Ф. и др., 2004;

Masakazu A., 1998;

Sakatani M., 2005].

Известно, что основной группой риска в отношении микобактериозов являются ВИЧ-инфицированные лица [Marras T., Daley C., 2002]. Проведённые исследования показали, что диссеминированная микобактериальная инфекция, вызванная M. avium intracellulare complex (MAC), развивается у 25% – 50% ВИЧ-положительных больных, причем риск диссеминации инфекционного процесса зависит от тяжести иммунодефицита [Afessa B., 2001;

Richter E. et al., 2002;

Adle-Biassette H. et al., 2003;

Bonard D. et al., 2004].

Особенностью заболеваний, вызываемых разными видами микобактерий, особенно на ранних стадиях, является сходная клиническая картина, что может привести к назначению больному неадекватной химиотерапии. Поэтому в настоящее время все большее внимание исследователи уделяют проблеме диагностики микобактериальной инфекции, вызванной M. tuberculosis, M. bovis, M. bovis BCG, а также нетуберкулезными микобактериями, в частности относящимися к комплексу MAIS.

В микобактериологических лабораториях видовая идентификация микобактерий основывается на культуральных свойствах, таких как пигментообразование, способность роста культуры при различных температурах и скорость роста, а также на биохимических свойствах, которые зависят от ферментативной активности разных видов микобактерий [Ильина Т.Б., 1975;

Оттен Т.Ф., Васильев А.В., 2005;

Rist N. et al., 1967]. По данным Т.Ф. Оттен и соавт. (2004), в среднем сроки идентификации нетуберкулёзных микобактерий этими методами составляют более 6 месяцев.

Внедрение в практику молекулярно-генетических методов открывает новые возможности для быстрого и точного определения вида микобактерий. Однако, сложность создания тест-систем для определения вида возбудителя объясняется очень незначительными различиями геномов микобактерий. Как правило, применяют сочетание методов: на первом этапе используют полимеразную цепную реакцию (ПЦР), на втором этапом – метод гибридизации с соответствующими олигонуклеотидами или рестрикционный анализ. Методом, контролирующим изучаемые последовательности, является секвенирование, которое применяется в референс-лабораториях.

Более приемлемым для лабораторной диагностики является анализ полиморфизма длин рестрикционных фрагментов (ПДРФ), позволяющий получить легко различимые рестрикционные профили для комплексов Mycobacterium tuberculosis, МАIS (M. avium, M. intracellulare, M. scrofulaceum) и других микобактерий [Wong D. et al., 2001].



Для дифференциального определения вида микобактерий комплекса M.

tuberculosis (M. tuberculosis, M. bovis, M. bovis BCG) используют ПЦР-системы, основанные на анализе делеции гена RD1 и повторяющихся элементов межгенной области оперона SenX3-RegX3 [Magdalena J. et al., 1998;

Cunningham J. et al., 2000].

И.Н. Корневой, В.В. Дёмкиным (2002) разработана ПЦР-система «ТУБ-ДИФ», идентифицирующая данные микобактерии. Видовая идентификация основана на различиях в длине специфического амплифицированного фрагмента. Вместе с тем в случае присутствия нескольких видов микобактерий в анализируемом образце требуется проведение дополнительного рестрикционного анализа полученных ампликонов.

В литературе описаны тест-системы, основанные на анализе вариабельных видоспецифичных нуклеотидных последовательностей гена hsp65, позволяющие идентифицировать комплексы Mycobacterium tuberculosis, MAIS (M. avium, M.

intracellulare, M. scrofulaceum), но эти методики требуют применения нескольких рестриктаз, что увеличивает время анализа [Wong D. et al., 2001].

Таким образом, существенным недостатком молекулярно-биологических тест систем для видовой идентификации микобактерий является диссонанс между сроками идентификации и технической сложностью существующих методов, что резко сокращает возможность их применения для нужд клиники. На основании вышесказанного задача разработки новых и совершенствование уже имеющихся быстрых и специфических методов видовой идентификации микобактерий остается по-прежнему актуальной.

Цель исследования Разработать комплекс молекулярно-генетических методов для видовой идентификации M. tuberculosis, M. bovis, M. bovis BCG и микобактерий комплекса MAIS (M. avium, M. intracellulare, M. scrofulaceum).

Задачи исследования 1. Осуществить клинико-диагностическую апробацию тест-системы «ТУБ ДИФ», для идентификации микобактерий M. bovis, M. bovis BCG и M. tuberculosis.

2. Разработать собственную тест-систему рестрикционного анализа для уточнения данных, полученных после применения «ТУБ-ДИФ».

3. Изучить возможность выявления микобактерий комплекса M. tuberculosis у больных различными заболеваниями, находящихся на лечении в Московском научно практическом центре борьбы с туберкулёзом Департамента здравоохранения города Москвы (МНПЦБТ) и Российской детской клинической больнице МЗ РФ (РДКБ).

4. Разработать тест-систему «MAIS-диф», которая может быть применена для одновременной идентификации M. tuberculosis, M. avium, M. intracellulare, M.

scrofulaceum.

5. Испытать тест-систему «MAIS-диф» на диагностическом материале и культурах кислотоустойчивых микобактерий, выделенных от больных, находящихся на лечении в МНПЦБТ и Московском городском центре борьбы со СПИДом Департамента здравоохранения города Москвы.

Научная новизна Усовершенствованы различные методические подходы обработки клинических образцов и выявления кислотоустойчивых микобактерий методом ПЦР. Подобраны рестриктазы и условия рестрикции для определения комплексов M. tuberculosis, MAIS, некоторых других видов НТМБ и осуществлён ПЦР-рестрикционный анализ для их характеристики.

В результате проведенных исследований впервые разработаны:

- тест-система рестрикционного анализа для уточнения вида микобактерий M.

bovis, M. bovis BCG и M. tuberculosis после проведения исследований с помощью тест системы «ТУБ-ДИФ»;

- тест-система идентификации видов микобактерий комплекса MAIS (M.

avium, M. intracellulare, M. scrofulaceum), а также некоторых других НТМБ и M.

tuberculosis на основе ПЦР-рестрикционного анализа (приоритетная справка №2004137089 от 2005 года).

Определены возможности и рамки применения вышеназванных тест-систем, позволяющих на основе ПЦР-анализа идентифицировать M. tuberculosis, M. bovis, M.

bovis BCG и микобактерии комплекса MAIS (Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium scrofulaceum).

Практическая значимость работы Методы идентификации микобактерий, основанные на ПЦР, дают возможность быстро (в течение 24-48 часов) и точно определить вид возбудителя, что позволяет рекомендовать их как наиболее перспективные методы диагностики микобактериозов. Возможность точной идентификации микобактерий в различном диагностическом материале позволяет своевременно назначить больным соответствующую химиотерапию, повысить её эффективность, сократить сроки и стоимость лечения.

Положения, выносимые на защиту 1. Результаты клинико-диагностической апробации отечественной тест системы «ТУБ-ДИФ» свидетельствуют о её эффективности для обнаружения МБТ.

Применение рестрикционного анализа повышает достоверность дифференциации M.

bovis и M. bovis BCG, основанной на методе полиморфизма длин рестрикционных фрагментов (рестриктазы RsaI и TaaI), клонируемых фрагментов межгенных последовательностей оперона SenX3-RegX3.

2. Применение рестрикционного анализа повышает достоверность дифференциации M. bovis и M. bovis BCG, основанной на методе полиморфизма длин рестрикционных фрагментов (рестриктазы RsaI и TaaI), клонируемых фрагментов межгенных последовательностей оперона SenX3-RegX3.

3. Разработанная тест-система «MAIS-диф» позволяет проводить видовую идентификацию нетуберкулезных микобактерий комплекса MAIS, некоторых других видов НТМБ и дифференциацию их от M. tuberculosis complex.

Апробация работы Материалы диссертации доложены на V Всероссийской научно-практической конференции «Генодиагностика инфекционных болезней», Москва 2004;

Российском национальном конгрессе «Человек и лекарство», Москва, 2005;

Всероссийской конференции молодых ученых «Актуальные вопросы фтизиатрии, пульмонологии и торакальной хирургии», Москва, 2006.

Публикации По теме диссертации опубликовано 7 статей, в том числе 2 в изданиях, рекомендованных ВАК России и методические рекомендации «Определение вида микобактерий комплексов MAIS и Mycobacterium tuberculosis методом рестрикционного анализа».

Структура и объем диссертации Диссертация изложена на 124 страницах машинописного текста и состоит из введения, обзора литературы, собственных исследований, заключения и выводов. В тексте содержится 12 рисунков и 18 таблиц. Библиография включает 143 источника литературы, из них 18 на русском и 125 на иностранных языках.





Содержание работы Материал и методы исследования Пациенты и диагностический материал В работе были использованы пробы ДНК, выделенные из 254 образцов различного биологического материала (мокрота – 146, бронхоальвеолярный лаваж – 3, кровь – 96, ликвор – 4, биоптаты из разных локализаций – 4, плевральный экссудат – 1), полученных от 228 больных, находившихся на лечении в отделениях клинической иммунологии, онкогематологии и химиотерапии РДКБ, стационаре МНПЦБТ, в городских клинических больницах №№ 12,15. Также анализировали музейные штаммы и выделенные от больных культуры туберкулезного комплекса (M.

tuberculosis H37Rv АТСС25618, M. bovis Ravenel СПбНИИФ, M. bovis BCG СПбНИИФ) и нетуберкулезных микобактерий (M. avium ГИСК, M. avium АТСС35712, M. intracellulare Астрахань МНПЦБТ, M. intracellulare ГИСК, M.

intracellulare АТСС35761, M. scrofulaceum АТСС35787, M. scrofulaceum Астрахань МНПЦБТ, M. chelonae ГИСК, M. fortuitum ГИСК, M. kansasii ГИСК). Наряду с этим исследовали штаммы кислотоустойчивых микобактерий (n=62) и комплекса M.

tuberculosis (n=4), выделенные от больных с подозрением на туберкулез, находящихся на лечении в МНПЦБТ, после посева биологического материала на плотные среды в центральной бактериологической лаборатории (ЦБЛ), а также бронхоальвеолярный лаваж (n=18), полученный от ВИЧ-инфицированных больных, находившихся на лечении в Московском центре борьбы со СПИДом Департамента здравоохранения города Москвы.

Сбор материала, хранение, выделение ДНК и детекцию для «Нестед-ПЦР», «МАIS-диф» проводили согласно методическим рекомендациям, разработанным в МНПЦБТ [Скотникова О.И. и др., 2001]. Для тест-систем «ТУБ-ДИФ» (ИМГ РАН, Россия), «Cobas Amplicor MTB» (Roche, Швейцария), «Нарвак Nested-PCR» (НПО «Нарвак», Россия), «Нарвак RT-PCR» (НПО «Нарвак», Россия) проводили согласно протоколам, предложенным фирмами-производителями.

Для определения ДНК туберкулезного комплекса применяли тест-системы «Сobas Аmplicor» (Roche, Швейцария) и «Нестед-ПЦР» (МНПЦБТ, Россия).

Определение вида микобактерий, входящих в M. tuberculosis complex Тест-система «Нарвак Nested-PCR» («Н-ПЦР»), созданная в НПО «Нарвак», представляет собой двухступенчатую, так называемую «нестед» модификацию метода ПЦР с использованием внутренних и внешних праймеров [Гребенникова Т.В.

и др., 1999]. Для индикации суммарной ДНК M. tuberculosis и M. bovis используют внешние праймеры Т2/Т2А в ПЦР-1 и внутренние Т4/Т4А в ПЦР-2. Для определения ДНК M. tuberculosis используют внешние праймеры Т1/Т1А в ПЦР-1 и внутренние Т3/Т3А в ПЦР-2. Тест-система «Нарвак Nested-PCR» предназначена для выявления и дифференциации ДНК M. tuberculosis и M. bovis. «Нарвак RT-PCR» («Н-РВ») – это модификация тест-системы «Нарвак Nested-PCR», адаптированная для проведения ПЦР в реальном времени. ПЦР проводили в амплификаторе «Терцик» (ДНК Технология, Россия), согласно программе амплификации, указанной фирмой производителем.

Тест-система «ТУБ-ДИФ» – это двухстадийная ПЦР, основанная на амплификации межгенного региона senX3-regX3 и позволяющая по разнице длин специфических амплифицированных фрагментов дифференцировать ДНК M.

tuberculosis, M. bovis, M. bovis BCG [Корнева И.Н. и др., 2002]. ПЦР проводили в амплификаторе «Терцик» (ДНК-Технология, Россия) согласно программе амплификации, указанной фирмой-производителем.

Рестрикционный анализ продуктов «ТУБ-ДИФ»

В МНПЦБТ разработана система рестрикционного анализа с использованием двух рестриктаз RsaI, TaaI для продуктов ПЦР, полученных после применения тест системы «ТУБ-ДИФ» в случаях затрудненной интерпретации результатов.

ПЦР проводили согласно требованиям фирмы-производителя (ИМГ РАН).

Реакционную смесь для каждой рестриктазы готовили отдельно, с учетом числа положительных проб после проведения ПЦР с помощью тест-системы «ТУБ ДИФ» (Х) и трех дополнительных проб, необходимых для постановки положительного контроля. Реакционные смеси для рестриктаз готовили с использованием необходимых буферов.

Полученную реакционную смесь тщательно перемешивали и разносили по мкл в пробирку. В каждую пробирку вносили по 15 мкл ампликонов, полученных после проведения ПЦР с помощью тест-системы «ТУБ-ДИФ», и помещали в водяную баню, с температурой воды 37С для рестриктазы RsaI и 65С для рестриктазы TaaI.

Пробирки инкубировали в термостате при температуре 37С для рестриктазы RsaI и 65С для рестриктазы TaaI, в течение 60 минут, после чего для прекращения рестрикции охлаждали, поместив на лёд в течение 3-5 минут.

Детекцию продуктов рестрикции проводили, используя горизонтальный электрофорез с этидиумом бромидом в 3% агарозном геле, при напряжении 10- В/см. Длины рестрикционных фрагментов определяли визуально при помощи маркера длин Gene Ruler 50 bp DNA Ladder (Fermentas Inc, США).

Определение вида нетуберкулезных микобактерий с помощью тест системы «MAIS-диф» (МНПЦБТ, Россия) Созданная в МНПЦБТ тест-система «MAIS-диф» (приоритетная справка №2004137089 от 2005 года) основана на ПДРФ гена hsp65 и состоит из двух последовательных этапов. На первом этапе проводится ПЦР фрагмента гена hsp65, второй этап представлен рестрикционным анализом ампликонов, полученных после проведения ПЦР. «MAIS-диф» предназначена для идентификации вида микобактерий комплекса MAIS, некоторых других видов нетуберкулезных микобактерий и их дифференциации от комплекса M. tuberculosis.

Проведение ПЦР гена hsp Реакционную смесь готовили из компонентов набора реагентов для проведения ПЦР с учетом числа пробирок, поступивших для тестирования содержащихся в них проб (Х) и дополнительных пробирок, необходимых для постановки положительного и отрицательного контроля.

Для амплификации фрагмента гена hsp65 использовали праймеры:

HSP-1 5GCCAAGAAGACCGATGACGT HSP-2 5GGTGATGACGCCCTCGTTGC Вода дистиллированная (для ПЦР) ПЦР – смесь (5х): 10 мМ трис-HCl pH 8,0;

50 мМ KCl;

0,5% твин 20;

5% формамид Раствор 1,5 мМ MgCl dNTP по 200 мкМ Праймеры по 5 мкМ ДНК-полимераза (BIOTAQ ДНК-полимераза) 3,75U Общий объем (47 х N) мкл Полученную реакционную смесь тщательно перемешивали и разносили по пробиркам, подготовленным для постановки ПЦР, из расчета 47 мкл на пробирку.

Обработанный биологический материал вносили в амплификационную смесь по мкл. Пробирки помещали в автоматический температурный циклер «Терцик» (ДНК Технология, Россия) и проводили амплификацию методом ПЦР. Профиль амплификации состоял из следующих этапов:

№ шага Время Количество Температура, С° программы выдержки циклов 1 94 (предварительная денатурация ДНК) 2 мин 94 (денатурация ДНК) 30с 2 62 (отжиг праймеров) 30с 72 (удлинение праймеров) 1 мин 3 72 (завершающая инкубация) 6 мин Детекцию продуктов амплификации проводили, используя горизонтальный электрофорез в TBE-буфере (0,089мМ трис-бората;

0,089М борной кислоты;

2мМ EDTA, рН 8,0) с этидиумом бромидом в 1,5% агарозном геле при напряжении 10- В/см.

Проведение ПДРФ гена hsp Реакционную смесь готовили с учетом числа проб, с положительной реакцией на содержание ДНК после проведения ПЦР гена hsp65 (Х) и дополнительных проб, необходимых для постановки положительного контроля. В пробирку объемом 0,5 мл вносили, отдельной для каждого компонента пипеткой, следующие реагенты набора для рестрикционного анализа в указанной ниже последовательности и количестве:

Буфер Y+/Tango (Fermentas Inc, США) 5 мкл Рестриктаза Hin6I (Fermentas Inc, США) 1,9U – 9,6 мкл Общий объем (14,6 х N) мкл Полученную реакционную смесь тщательно перемешивали и разносили по пробиркам, подготовленным для постановки рестрикционного анализа, из расчета 14,6 мкл на пробу. Затем в каждую пробирку вносили по 17 мкл ампликонов, полученных после проведения ПЦР гена hsp65, и помещали в водяную баню, с температурой воды 37С. Пробирки инкубировали в термостате при температуре 37С в течение 70 минут, после чего для прекращения рестрикции охлаждали, поместив на лёд в течение 3-5 минут.

Детекцию продуктов рестрикции проводили, используя горизонтальный электрофорез с этидиумом бромидом в 3% агарозном геле, при напряжении 10- В/см. Длины рестрикционных фрагментов определяли визуально при помощи маркера длин Gene Ruler 50 bp DNA Ladder (Fermentas Inc, США).

Статистическая обработка данных Для оценки статистической значимости различий между сопоставляемыми величинами (количество исследуемых вариантов) использовали критерий Стьюдента.

Различия считались достоверными при р0,05, высоко достоверными при р0,01, недостоверными при р0,05 (программа Matlab, версия 6,5).

Чувствительность и специфичность метода определяли по S. Rusch-Geroles et.

al. (1999).

Результаты собственных исследований Для определения ДНК туберкулезного комплекса применяли тест-системы «Сobas Аmplicor» (Roche, Швейцария) и «Нестед-ПЦР» (МНПЦБТ, Россия). Для дифференциации представителей туберкулезного комплекса апробировали две тест системы фирмы «НАРВАК» (Россия), специфичные в отношении туберкулезного комплекса и M. bovis и ПЦР-систему «ТУБ-ДИФ» (ИМГ РАН), позволяющую идентифицировать некоторые виды, входящие в туберкулезный комплекс. Поскольку тест-системы «НАРВАК» специфичны в определении вида M. bovis, мы изучали двухэтапную «Н-ПЦР» и одноэтапную ПЦР, в режиме реального времени «Н-РВ» на штаммах с заведомо известным видом. Из 7 исследуемых штаммов M. bovis только в 3 случаях с помощью двухэтапной ПЦР и в 1 случае с помощью одноэтапной ПЦР в реальном времени получен положительный результат определения вида микобактерий, что малоэффективно. Несомненным преимуществом тест-системы «ТУБ-ДИФ» является простота исполнения и возможность дифференцировать ДНК M. bovis, M. tuberculosis и M. bovis BCG.

Для сравнения эффективности двух тест-систем «Cobas Amplicor MTB» («СА») и «ТУБ-ДИФ» исследовали 128 образцов ДНК, полученных из мокроты больных с различными формами туберкулеза или с подозрением на туберкулез. Наличие в указанных пробах ДНК МБТ ранее определено с помощью тест-системы «СА».

Результаты представлены в таблице 1.

Необходимо отметить, что для 108 образцов получены положительные результаты выявления ДНК M. tuberculosis complex с помощью тест-системы «ТУБ ДИФ». Распределение этих результатов в зависимости от вида микобактерий было следующим: ДНК M. tuberculosis обнаружена в 105 случаях, M. bovis в двух и M. bovis BCG в одном. Анализ полученных данных показал совпадение результатов определения наличия и отсутствия микобактерий туберкулезного комплекса в образцах двумя тест-системами.

Таблица 1.

Результаты выявления Mycobacterium tuberculosis complex с помощью тест-систем «СА»

и «ТУБ-ДИФ» (n=128) Тест-системы, применяемые для определения микобактерий Результаты p туберкулезного комплекса «СА»1 «ТУБ-ДИФ»

Положительные 102 (79,8%) 108 (84,4%) p0, Отрицательные 16 (12,5%) 20 (15,6%) р0, 1) – в таблицу не включены результаты «СА» с отрицательным внутренним контролем (n=10) По всей вероятности незначительное различие в частоте выявления микобактерий двумя тест-системами связано с тем, что в тест-системе «ТУБ-ДИФ»

отсутствует система внутреннего контроля, вследствие чего характеристика результата может быть только положительная или отрицательная. Расхождение данных для отрицательных образцов может быть объяснено тем, что отрицательные результаты по «CA» включает в себя данные с отрицательным внутренним контролем, что означает, что реакция не прошла, а это может быть связано с наличием в образце ингибиторов амплификации. Известно, что применение двухэтапной ПЦР позволяет ослабить воздействие примесей на выявление ДНК МБТ из биологического материала.

Хотя разница в частоте выявления ДНК МБТ между двумя тест-системами не достоверна, преимуществом «ТУБ-ДИФ» является возможность определения не только МБТ, но и дифференциации M. bovis и M. bovis BCG.

Тест-система, созданная в ИМГ РАН, «ТУБ-ДИФ» более проста в исполнении.

На электрофореграмме (рис.1) видно четкое отличие M. tuberculosis (350 п.н.) от M.

bovis (370 п.н.) и M. bovis BCG (270 п.н.) (рис. 1).

1 2 3 4 5 6 Рис. 1. Электрофореграмма разделения M. tuberculosis, M. bovis, M. bovis BCG с помощью тест-системы «ТУБ-ДИФ»

1-4 – ДНК, выделенная из диагностического материала больных туберкулезом;

5 – M.

bovis BCG, СПбНИИФ;

6 – M. tuberculosis H37Rv, АТСС25618;

7 – M. bovis Ravenel, СПбНИИФ В ряде случаев при разделении образцов ДНК с помощью электрофореза четкого разделения сигналов не получалось и возникали трудности определения вида микобактерий (рис. 2).

1 2 3 Рис. 2. Электрофореграммы разделения ампликонов ДНК МБТ, полученных с помощью «ТУБ-ДИФ»

1 – M. bovis BCG;

2 – неинтерпретируемый результат;

3 – M. tuberculosis;

4 – M. bovis В связи с этим в МНПЦБТ отработаны условия рестрикционного анализа, с помощью которого ДНК неинтерпретируемых полос можно дифференцировать.

Подбор рестриктаз проводили с помощью компьютерных программ Primer Primier 5 и BioEdit v.7.0.1. Были отобраны рестриктазы RsaI и TaaI с сайтами рестрикции GT^AC и AC_N^GT соответственно. Длины рестрикционных фрагментов в парах нуклеотидов для рестриктазы RsaI составили: M. bovis – 357 п.н., M.

tuberculosis – 221 п.н., 82 п.н., M. bovis BCG – 237 п.н.;

для рестриктазы TaaI: M. bovis – 328 п.н., 23 п.н., M. tuberculosis – 303 п.н., M. bovis BCG – 237 п.н. Результаты представлены на рисунке 3.

1 2 3 4 5 Рис. 3. Рестрикционные профили M. tuberculosis, M. bovis, M. bovis BCG после обработки ампликонов рестриктазами RsaI и TaaI 1 – M. bovis 2 – M. tuberculosis RsaI 3 – M. bovis BCG 4 – M. bovis 5 – M. tuberculosis TaaI 6 – M. bovis BCG Применение дополнительного рестрикционного анализа, позволило отличить плохо дифференцируемые сигналы, полученные после проведения ПЦР.

Апробацию тест-системы «ТУБ-ДИФ» проводили на ДНК МБТ, выделенной от больных различными заболеваниями.

Известно, что 30% населения являются инфицированнными МБТ [Cole T., 2005]. Вполне возможно, что при иммунодефиците связанном с каким-то заболеванием, активизируется размножение МБТ и увеличивается вероятность их выявления. По сравнению с МБТ, M. bovis выявляют значительно реже. По данным литературы частота выделения этого вида микобактерий зависит от заболеваемости туберкулезом домашних животных, в первую очередь крупного рогатого скота и географического региона в котором проводилось исследование [Vordermeier H. et al., 2000;

Grange J., 2001]. Надо отметить, что генодиагностикой этой инфекции никто специально не занимался, и эти литературные данные могут быть весьма приблизительными. Выявление M. bovis BCG можно объяснить высокой чувствительностью методов на основе ПЦР, вследствие чего возможно выявления ДНК не только непосредственно микобактерий, но и их фильтрующихся L-форм. По крайней мере, ДНК M. bovis, M. bovis BCG были выявлены у больных лимфоаденитом, хронической гранулематозной болезнью, мезентеральной лимфоаденопатией и т.д.

При помощи тест-системы «ТУБ-ДИФ» проанализировано 254 образца различного биологического материала (кровь, мокрота, бронхоальвеолярный лаваж, ликвор), полученного от больных с различными заболеваниями и подозрением на микобактериальную инфекцию.

Распределение полученных результатов по двум группам (взрослые пациенты стационара МНПЦБТ и дети, находившиеся на лечении в РДКБ) представлено в таблице 2.

Таблица 2.

Выявление микобактерий туберкулезного комплекса в диагностическом материале больных, находившихся на лечении в МНПЦБТ и РДКБ (n=245) № МНПЦБТ (n=133) РДКБ (n=112) Варианты результатов п/п кол-во % кол-во % 1. 104 78,20% 26 23,21% M. tuberculosis 2. 4 3,01% 5 4,46% M. bovis 3. 2 1,50% 11 9,82% M. bovis BCG 4. Отрицательный 23 17,29% 70 62,50% Из данных, представленных в таблице 2, видно, что у взрослых больных с подозрением на туберкулез M. tuberculosis выявляли в три раза чаще (78,2%), чем у больных детей с подозрением на микобактериальную инфекцию (23,21%), что составляло 94,5% и 62% от выявления M. tuberculosis complex. Результаты определения M. bovis примерно совпадали для двух групп больных и составили 3,01% и 4,46% (3,6% и 12% от выявления M. tuberculosis complex). Частота определения M.

bovis BCG составили 1,50% у больных из МНПЦБТ и 9,82% для пациентов детского стационара РДКБ (1,8% и 26% от выявления M. tuberculosis complex). Значительные отличия распределения по группам пациентов этого вида микобактерий можно объяснить тем, что вакцинный штамм M. bovis BCG вводят детям до 16 лет в соответствии с календарем профилактической вакцинации РФ, вследствие чего ДНК этого вида микобактерий определяли в основном у пациентов детской больницы.

Особый интерес представляли больные с признаками первичного иммунодефицита и онкогематологическими заболеваниями с подозрением на наличие микобактерий туберкулезного комплекса, среди которых присутствовали и M. bovis и M. bovis BCG.

Исследование диагностического материала, полученного от больных с признаками первичного иммунодефицита, показал, что в 21,1% случаях у них были выявлены микобактерии туберкулезного комплекса, из которых 42,8% – M.

tuberculosis, 28,6% – M. bovis, 28,6% – M. bovis BCG (табл. 3).

Таблица 3.

Выявление микобактерий туберкулезного комплекса в диагностическом материале больных с установленным первичным иммунодефицитом, находящихся на лечении в отделении клинической иммунологии РДКБ (n=33) № Результаты Кол-во % п/п 1. 3 9,09% M. tuberculosis 2. 2 6,06% M. bovis 3. 2 6,06% M. bovis BCG 4 Отрицательные 26 78,79% Результаты, полученные при исследовании диагностического материала от детей с онкогематологическими заболеваниями (n=24) показали, что ДНК микобактерий туберкулезного комплекса была выявлена в 37,5% случаев, из которых в 100% были идентифицированы M. tuberculosis.

Таким образом, при использовании технологий, применяемых для выявления ДНК микобактерий туберкулезного комплекса, необходим дифференцированный подход с учетом возможности применения различных тест-систем. Для выявления микобактерий туберкулезного комплекса желательно использовать системы, основанные на клонировании различных последовательностей. Определение вида представителей M. tuberculosis complex у больных, как с иммунодефицитом, так и при различных патологических состояниях, является важным для врачей при назначении больным соответствующего лечения.

Определение вида микобактерий входящих в комплекс MAIS и дифференциация их от M. tuberculosis complex с помощью ПЦР-рестрикционного анализа Нетуберкулезные микобактерии широко распространенны в природе, их выделяют из естественных водоемов, систем водоснабжения, почвы. Одним из наиболее важных свойств НТМБ является их способность при определенных условиях вызывать заболевания человека – микобактериозы [Оттен Т.Ф., Васильев А.В., 2005;

Katoch V., 2004]. Поскольку микробиологические методы, особенно при посеве на плотные среды, длительны по времени и их результативность недостаточно высока даже при использовании жидких сред, внедрение молекулярно-биологических методов, сокращающих определение вида до 24-48 часов, и позволяющих в 90% случаев получить достоверные результаты важно для своевременного назначения больному адекватного лечения [Скотникова О.И., 2005;

Heifets L., 2004;

Katoch V., 2004].

Была предпринята попытка, адаптировать метод, предложенный Wong D. et al., (2001) для определения вида микобактерий, входящих в комплекс MAIS, и отличия их от комплекса M. tuberculosis. На начальном этапе исследования изучали рестрикционные профили комплекса MAIS и M. tuberculosis после обработки ампликонов, синтезированных с фрагмента гена hsp65, рестриктазой Cfr13I, которую предложили Wong D. et al., (2001). Результаты представлены на рисунке 4.

1 2 3 Рис. 4. Профили рестрикции комплекса MAIS после обработки ампликонов, синтезированных с фрагмента гена hsp65 рестриктазой Cfr13I 1 – M. scrofulaceum ATCC35787;

2 – M. intracellulare ATCC35761;

3 – M. avium ATCC35712;

4 – M. tuberculosis H37Rv ATCC Длины рестрикционных фрагментов после использования рестриктазы Cfr13I составляли для M. tuberculosis – 200 п.н., 40 п.н., для M. avium и M. intracellulare – п.н., 125 п.н., 100 п.н., 70 п.н. и для M. scrofulaceum – 200 п.н., 125 п.н., 100 п.н., п.н.

Результаты рестрикционного анализа, представленные на рисунке 4, позволили установить отличие профилей рестрикции комплекса MAIS (1,2,3) от M. tuberculosis (4). При этом наблюдалось полное совпадение рестрикционных профилей M. avium (3) и M. intracellulare (2). В связи с тем, что с помощью рестриктазы Cfr13I нельзя точно дифференцировать виды M. avium и M. intracellulare, мы попытались из большого спектра рестриктаз подобрать ту из них, с помощью которой можно было бы получить специфичные рестрикционные профили для этих видов микобактерий.

В результате дальнейшего подбора сочетания двух факторов: наличия определенных последовательностей в изучаемом фрагменте гена и активности исследуемой рестриктазы к этим последовательностям, выбрана рестриктаза Hin6I, оказавшаяся изошизомером CfoI и позволяющая получить четкое разделение видов M. avium и M. intracellulare. Результаты представлены на рисунке 5, где видны четкие различия рестрикционных профилей комплексов M. tuberculosis (7), MAIS (4,5,6), а также M. kansasii, M. fortuitum/ M. chelonae. Длина рестрикционных фрагментов после обработки рестриктазой Hin6I для M. tuberculosis complex составила 125 п.н., 85 п.н., 75 п.н., M. avium 185 п.н., 85 п.н., M. intracellulare 185 п.н., 100 п.н., M. scrofulaceum 185 п.н., 75 п.н., 40 п.н., M. fortuitum 125 п.н., 85 п.н., 50 п.н., M. chelonae 125 п.н., п.н., 50 п.н., M. kansasii 125 п.н., 75 п.н., 50 п.н.

1 2 3 4 5 6 7 М Рис. 5. Профили рестрикции различных видов рода Mycobacterium, полученные после обработки рестриктазой Hin6I 1 – M. kansasii ГИСК, 2 – M. fortuitum ГИСК, 3 – M. chelonae ГИСК, 4 – M.

scrofulaceum АТСС35787, 5 – M. intracellulare АТСС35761, 6 – M. avium АТСС35712, 7 – M.

tuberculosis H37Rv ATCC25618, М – маркер (шаг маркера представлен с правой стороны электрофореграммы и выражен в парах нуклеотидов) Таким образом, с помощью одной рестриктирующей эндонуклеазы Hin6I можно дифференцировать виды микобактерий, входящие в комплекс MAIS, и отличить их от M.tuberculosis complex, что значительно упрощает и удешевляет исследование по сравнению с тест-системами, описанными в литературе, где для таких же целей используются две и более рестриктазы [Patel R. et al. 1986;

Telenti A.

et al., 1993;

Devallois A. et al., 1997;

Roth A. et al., 2000;

Brunello F. et al., 2001]. Кроме того, использование одной рестриктазы Hin6I позволяет определить вид не только представителей комплекса MAIS, но и некоторых других видов микобактерий (M.

kansasii, M. fortuitum/M. chelonae, M. xenopi, M. gordonae, M. marinum и.т.д.), что расширяет возможности разработанной нами тест-системы «MAIS-диф» (рис. 6).

M 1 2 3 4 5 6 7 8 9 10 11 M Рис. 6. Профили рестрикции различных видов рода Mycobacterium, полученные после обработки рестриктазой Hin6I 1 – M. xenopi;

2 – M. marinum;

3 – M. gordonae;

4 – M. szulgai;

5 – M. kansasii;

6 – M.

intracellulare;

7 – M. chelonae;

8 – M. fortuitum;

9 – M. intracellulare;

10 – M. avium;

11 – M.

tuberculosis complex;

М – маркер Проведен анализ штаммов, выделенных от больных с подозрением на туберкулез. Сравнение профилей рестрикции ДНК исследуемых образцов с ДНК контрольных штаммов (заведомо известных видов) показало, что исследуемые культуры можно отнести к нетуберкулезным микобактериям, что было подтверждено данными микобактериологической идентификации.

Необходимо отметить, что для различных видов микобактерий характерно постоянство рестрикционной картины, так как в процессе рестрикции происходит образование фрагментов ДНК определенной длины. Штаммы микобактерий одних и тех же видов, полученные из различных музеев, имели одни и те же профили рестрикции, что говорит о высокой специфичности тест-системы.

Все указанные культуры микобактерий, выделенные повторно из материала от одних и тех же больных, относились к одному и тому же виду. Это подтверждает их этиологическую роль.

Результаты определения ПЦР-рестрикционным анализом и бактериологическими методами вида микобактерий, выделенных из диагностического материала больных с подозрением на туберкулез.

Для изучения возможности использования метода ПДРФ гена hsp65 в целях диагностики были исследованы музейные штаммы НТМБ и M. tuberculosis complex, 66 культур микобактерий, выделенных в ЦБЛ МНПЦБТ из диагностического материала 45 больных с подозрением на туберкулез, а так же 18 образцов ДНК, выделенной из бронхоальвеолярного лаважа 18 ВИЧ-инфицированных больных с подозрением на туберкулез находившихся на лечении в Московском городском центре борьбы со СПИДом Департамента здравоохранения города Москвы.

Частота выявления НТМБ, выделенных от больных, с помощью метода ПДРФ гена hsp65, в зависимости от видовой принадлежности представлена в таблице 4.

Таблица 4.

Видовая принадлежность НТМБ методом ПДРФ гена hsp65 и их распределение по видам № п/п Название вида микобактерий Количество % 1. 20 35,71% M. avium 2. 10 17,86% M. fortuitum/M. chelonae 3. 9 16,07% M. kansasii 4. 7 12,5% M. xenopi 5. 4 7,14% M. tuberculosis complex 6. 3 5,36% M. intracellulare 7. 2 3,57% M. gordonae 8. 1 1,79% M. marinum 56 100% Итого:

Из таблицы 4 видно, что в наибольшем количестве случаев в исследуемых образцах представлены M. avium (35,71%), меньше M. fortuitum (17,86%), еще меньше M. kansasii (16,07%) и т.д.

Значительный интерес представляло сопоставление результатов идентификации НТМБ, полученных разными методами (табл. 5).

Сравнение результатов определения видов микобактерий двумя методами показало высокий процент (88,6%) конкордантности полученных результатов.

Несовпадения в большинстве случаев можно объяснить наличием в диагностическом материале двух видов микобактерий, то-есть смешанных культур. После рассева культур, выделенных из диагностического материала 5 больных на плотной среде Левенштейна-Йенсена, на чашки Петри со средой Middlebrook 7H11 получен рост колоний с различными культуральными свойствами, что подтвердило предположение о возможном выделении из диагностического материала этих пациентов так называемых смешанных культур, идентификация которых связана с определенными сложностями. При применении метода ПДРФ гена hsp65 и микробиологической идентификации получено полное совпадение результатов. Чувствительность метода ПДРФ гена hsp65 составила 100%, a специфичность 88,6%.

Таблица 5.

Сравнение распределения по видам культур микобактерий (n= 53) методами ПДРФ гена hsp65 и микробиологической идентификации № Микробиологическая Вид микобактерий ПДРФ гена hsp п/п идентификация 1. M.avium 2. M. intracellulare 3. M. fortuitum 4. M. chelonae 5. 7 M. kansasii 6. 7 M. xenopi 7. 4 M. tuberculosis complex 8. 2 M. gordonae 9. 1 M. marinum 10. - M. flavescens В случаях смешанных культур профиль рестрикции анализируемой культуры изменяется (рис.7).

1 2 М Рис. 7. Полученные после обработки рестриктазой Hin6I профили рестрикции культур кислотоустойчивых микобактерий, выделенных из диагностического материала больных с подозрением на туберкулез 1 – 28857(2);

2 – 28857(1);

М – маркер На рисунке 7 представлен случай наложения профилей рестрикции различных видов микобактерий M. intracellulare и M. fortuitum/M. chelonae (2), полученный при изучении смешанной культуры 28857. Интерпретация результатов не составила труда, и рестрикционный профиль трактовали как идентичный M. intracellulare, но при ПДРФ анализе колоний, выделенных при рассева на чашках со средой Middlebrook 7H11, один вид колоний четко идентифицировался как M. fortuitum/M.

chelonae (1), а другой характеризовался наложением профилей рестрикции характерных для M. intracellulare и M. fortuitum/M. chelonae (2). Таким образом с помощью тест-системы «MAIS-диф» можно идентифицировать несколько видов микобактерий в исследуемом материале.

У 8 больных отмечено повторное (в 6 случаях двукратное и в 2 троекратное) выделение культур НТМБ из диагностического материала. Причем из диагностического материала 7 больных были выделены одноименные виды микобактерий, а в одном случае разноименные (№№ 31079 – M. avium, 1498 – M.

fortuitum/ M. chelonae). Результаты определения вида микобактерий в случаях повторного выделения культур НТМБ полностью совпадали с данными микробиологической идентификации.

После проведения идентификации культур НТМБ с помощью тест-системы «MAIS-диф» была предпринята попытка адаптировать эту систему для определения вида микобактерий, используя ДНК, выделенную непосредственно из диагностического материала. Поскольку наибольшему риску развития микобактериозов подвержены лица, страдающие иммунодефицитами, в первую очередь, ВИЧ-инфекцией и СПИДом, было решено использовать для анализа ДНК, полученную из биологического материала таких больных. ДНК была выделена в соответствии с методическими рекомендациями, разработанным в МНПЦБТ [Скотникова О.И. и др., 2001], из 18 образцов бронхоальвеолярного лаважа ВИЧ инфицированных больных, любезно предоставленных Московским городским центром борьбы со СПИДом Департамента здравоохранения города Москвы. После проведения ПДРФ гена hsp65 было получено 17 отрицательных и 1 положительный результат, профиль рестрикции которого соответствовал M. tuberculosis complex. По всей видимости, для определения вида микобактерий непосредственно в диагностическом материале ВИЧ-инфицированных больных не хватало ДНК для ее рестрикционного анализа, что диктует необходимость либо увеличивать объем исследуемого образца, либо проводить культуральное исследование диагностического материала для выделения чистой культуры микобактерий.

Таким образом, необходимость своевременной диагностики микобактериальной инфекции, вызванной представителями M. tuberculosis complex (M. bovis, M. bovis BCG) и НТМБ, ставит перед лабораторией задачу быстрой и точной видовой идентификации микобактерий. Бесспорно, наиболее отвечающими этой задаче являются молекулярно-генетические методы, позволяющие за короткий срок дать ответ о видовой принадлежности представителей рода Mycobacterium.

Выводы 1. Определение полиморфизма длин рестрикционных фрагментов ДНК с помощью рестриктаз (RsaI и TaaI) после проведения ПЦР-диагностики МБТ комплекса повышает специфичность видовой идентификации M.tuberculosis, M. bovis, M. bovis BCG с получением результатов в течение 24-48 часов.

2. Частота обнаружения ДНК МБТ комплекса у больных туберкулезом или с подозрением на туберкулез (n=133) ДНК микобактерий туберкулезного комплекса достигает 82,7% случаев, из них 94,5% приходится на долю M. tuberculosis, 3,6% – M.

bovis, 1,8% – M. bovis BCG.

3. У детей с первичным иммунодефицитом (n=33) частота обнаружения ДНК комплекса МБТ не превышает 21,1% случаев, при этом доля M.tuberculosis в 1,5 раза выше (42,8%) по сравнению с M. bovis (28,6%) и M. bovis BCG (28,6%).

4. У детей с онкогематологическими заболеваниями (n=24) частота обнаружения ДНК микобактерий туберкулезного комплекса составляет 37,5% случаев, причем исключительно за счет M.tuberculosis (100%).

5. Впервые полученная тест-система «MAIS-диф», разработанная на основе клонирования определенных участков гена hsp65 с последующей обработкой их рестриктазой Hin6I, позволяет за 24-48ч идентифицировать микобактерии комплекса MAIS, некоторые другие виды НТМБ (M. fortuitum, M. kansasii, M. xenopi, M.

gordonae, M. marinum), и дифференцировать их от M. tuberculosis complex, что упрощает и удешевляет анализ по сравнению с тест-системами, использующими две и более рестриктазы.

6. Результаты видовой идентификации микобактерий комплекса MAIS микробиологическим методом и ПДРФ совпадают в 88,6% случаев, за исключением смешанных культур микобактерий.

7. Проведенная с помощью тест-системы «MAIS-диф» идентификация кислотоустойчивых микобактерий (n=56),выделенных у больных, находившихся на лечении в противотуберкулезных учреждениях Москвы, позволила определить их видовой состав, представленный следующими возбудителями: в 35,7% – M. avium;

17,9% – M. fortuitum/M. chelonae;

16,1% – M. kansasii;

12,5% – M. xenopi;

7,1% – M.

tuberculosis complex;

5,4% – M. intracellulare;

3,6% – M. gordonae;

1,8% – M. marinum.

Список работ, опубликованных по теме диссертации 1. Краснова М.А., Скотникова О.И., Кондратенко И.В., Кадникова О.Н., Галкина Е.В. Клиническое применение тест-системы для идентификации микобактерий M. tuberculosis, M. bovis, M. bovis BCG// В сб.: Генодиагностика инфекционных болезней. – М. – 2004. – Т1. – с. 209-211.

2. Потапова Н.И., Гребенникова Т.В., Забережный А.Д., Краснова М.А., Скотникова О.И., Алипер Т.И., Непоклонов Е.А. Разработка тест-системы на основе ПЦР в реальном времени для дифференциальной диагностики микобактерий// Вестник Российского Университета Дружбы Народов. – 2004. – №4. – с. 300-308.

3. Потапова Н.И., Гребенникова Т.В., Забережный А.Д., Краснова М.А., Скотникова О.И., Дорожкова И.Р., Мороз А.М. Оценка эффективности метода полимеразной цепной реакции в реальном времени для диагностики туберкулёза// Материалы Российского национального конгресса «Человек и лекарство». – М. – 2005.

4. Скотникова О.И., Галкина К.Ю., Носова Е.Ю., Краснова М.А., Мороз А.М.

Характеристика чувствительности Mycobacterium tuberculosis к рифампицину и изониазиду посредством определения мутаций в генах rpoB, katG, inhA, oxyR, kasA различными молекулярно-биологическими методами// Пробл. туб. – 2005. – №8. – с.

42-45.

5. Краснова М.А. Определение вида микобактерий комплекса MAIS и M.

tuberculosis complex молекулярно-генетическими методами// В сб.: Актуальные вопросы фтизиатрии, пульмонологии и торакальной хирургии. Материалы Всероссийской конференции студентов и молодых ученых, посвященной всемирному дню борьбы с туберкулезом. – М. – 2006. – с. 60.

6. Краснова М.А., Макарова М.В., Скотникова О.И., Мороз А.М.

Идентификация микобактерий комплекса MAIS и M. tuberculosis методом полиморфизма длин рестрикционных фрагментов гена hsp65// БЭБиМ. – 2006. – №8.

– с. 188-191.

7. Краснова М.А., Макарова М.В., Скотникова О.И. Определение вида микобактерий комплексов MAIS и Mycobacterium tuberculosis методом рестрикционного анализа// Методические рекомендации МНПЦБТ. – М. – 2007. – с.

8. Краснова М.А., Макарова М.В., Дорожкова И.Р., Скотникова О.И., Мороз А.М. Определение вида микобактерий комплекса MAIS и M.tuberculosis complex молекулярно-генетическими методами// В сб.: Научные труды (к 80-летию вед.

противотуб. учрежден. Москвы, 10-летию МНПЦБТ). В.И. Литвинов (титул.ред.). – М.: Медицина и жизнь. – 2007. – с. 200-204.

Список сокращений БЦЖ (BCG) (Bacillus Calmette-Guerin) - противотуберкулезная вакцина ГИСК Государственный научно-исследовательский институт стандартизации и контроля медицинских и биологических препаратов им. Л.А. Тарасевича Министерства здравоохранения и социального развития РФ МБТ Mycobacterium tuberculosis МНПЦБТ Московский городской научно-практический центр борьбы с туберкулезом Департамента здравоохранения города Москвы ИМГ РАН Институт молекулярной генетики Российской Академии Наук НТМБ нетуберкулезные микобактерии п.н. пары нуклеотидов ПДРФ полиморфизм длин рестрикционных фрагментов ПЦР полимеразная цепная реакция РДКБ Российская детская клиническая больница Министерства здравоохранения и социального развития РФ СПбНИИФ Санкт-Петербургский научно-исследовательский институт фтизиопульмонологии Министерства здравоохранения и социального развития РФ ЦБЛ центральная бактериологическая лаборатория МНПЦБТ MAC Mycobacterium avium-intracellulare complex MAIS Mycobacterium avium-intracellulare-scrofulaceum complex

 

Похожие работы:





 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.