авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Астрологический Прогноз на год: карьера, финансы, личная жизнь


“детекция и мониторинг специфической реаранжировки генов иммуноглобулинов в процессе лечения острых лимфобластных лейкозов”.

На правах рукописи

Давидян Юлия Рубеновна “Детекция и мониторинг специфической реаранжировки генов иммуноглобулинов в процессе лечения острых лимфобластных лейкозов”.

14.00.29 - Гематология и переливание крови

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата медицинских наук

Москва, 2007 2

Работа выполнена в Государственном учреждении Гематологический Научный центр Российской Академии Медицинских Наук

Научный консультант:

доктор медицинских наук Е.Н. Паровичникова

Официальные оппоненты:

доктор биологических наук Н. И. Дризе доктор медицинских наук, профессор А. И. Карачунский Ведущее научное учреждение:

Московский Научно-Исследовательский Онкологический институт им. П.А.Герцена Министерства Здравоохранения Российской Федерации

Защита состоится "11 " апреля 2007 г. в 14 час.

на заседании диссертационного Совета Д 001.042.01 при Государственном учреждении Гематологический Научный центр Российской Академии Медицинских Наук по адресу: 125167 Москва, Новозыковский проезд, д.4а

С диссертацией можно ознакомиться в библиотеке Государственного учреждения Гематологический Научный центр Российской Академии Медицинских Наук

Автореферат разослан " 6 " марта 2007 года

Ученый секретарь диссертационного Совета кандидат медицинских наук Е.Е. Зыбунова Актуальность проблемы.

Несмотря на интенсификацию лечения и возможность достижения полной ремиссии у 80-85% взрослых больных острым лимфобластным лейкозом (ОЛЛ), длительная безрецидивная выживаемость больных не превышает 30-40%. Как известно, при ОЛЛ существует множество прогностических факторов, определяющих эффективность терапии: возраст пациента, число лейкоцитов в дебюте заболевания, иммунофенотип бластных клеток и цитогенетические аномалии, сроки достижения ремиссии [Hoelzer D., Hematology, 2002]. Эти факторы в определенной степени позволяют проводить дифференцированную терапию ОЛЛ, что в ряде случаев значительно улучшает долгосрочные результаты. Одним из весомых факторов прогноза является чувствительность опухолевых клеток к преднизолону, определяемая с помощью подсчета числа бластных клеток в периферической крови или костном мозге на 7-ой день монотерапии этим препаратом. Так, процент достижения полной ремиссии у больных ОЛЛ, у которых бластные клетки чувствительны к преднизолону, составляет 87%. Кроме того, доказано, что чувствительность опухолевых клеток к преднизолону влияет и на долгосрочные результаты терапии ОЛЛ: общая и безрецидивная выживаемость при чувствительности бластных клеток к преднизолону составляет 33% и 32%, при отсутствии – 22% и 17%, соответственно [Annino L., Blood, 2002]. Этот фактор прогноза стал одним из ключевых в ходе создания нового протокола «ОЛЛ-2005», разработанного в отделении химиотерапии гемобластозов и трансплантации костного мозга.

Исключительно важными факторами прогноза при острых лимфобластных лейкозах являются обнаружение специфических индивидуальных маркеров опухолевых клеток и динамическое исследование минимальной резидуальной болезни (МРБ). При мониторинге МРБ в ходе проведения терапии ОЛЛ европейскими исследователями была выявлена значимая корреляция между уровнем определяемого остаточного клона и вероятностью развития рецидива. В случае обнаружения МРБ риск развития рецидива возрастает в 5-10 раз. Медиана длительности периода между обнаружением минимальной резидуальной болезни и возникновением рецидива составляет 4,1 месяца [van Dongen J.J.M., Lancet, 1998. Raff T., Blood, 2006].

Существует несколько методов, используемых для исследования минимальной остаточной популяции лейкемических клеток: определение аберрантного иммунофенотипа методом проточной флюорометрии, флюоресцентная гибридизация in situ (FISH) для детекции хромосомных перестроек, выявление хромосомных поломок с помощью молекулярно биологического метода (полимеразная цепная реакция, ПЦР). Следует отметить, что хромосомные аберрации являются «идеальными мишенями» для молекулярного мониторинга МРБ. Однако проблема состоит в том, что эти маркеры выявляются далеко не у всех больных. Поэтому требуются иные, более универсальные подходы к детекции и мониторингу МРБ, в частности, определение клональных перестроек генов иммуноглобулинов и Т-клеточных рецепторов с помощью ПЦР. Чувствительность этого метода высока:

определяется 1 опухолевая клетка на 1000 – 10000 нормальных. Динамическое исследование специфической реаранжировки генов иммуноглобулинов и Т клеточных рецепторов требует обнаружения индивидуальной молекулярной метки в дебюте болезни и создания индивидуальных для каждого больного праймеров. Только в этом случае можно отслеживать минимальную остаточную популяцию лейкемических клеток у каждого больного ОЛЛ.

Таким образом, современное лечение ОЛЛ базируется не только на определении молекулярно-биологических, иммунологических характеристик опухолевых клеток, но и на оценке изменения числа лейкемических клеток в процессе лечения. Достижение молекулярной ремиссии и ее сохранение в течение терапии является одним из важнейших и независимых факторов прогноза при ОЛЛ и служит основой для разработки оптимальных дифференцированных программ лечения ОЛЛ. Мониторинг минимальной резидуальной болезни при помощи ПЦР, использующей индивидуальные пациент-специфические праймеры, позволяет идентифицировать пациентов с высокой вероятностью развития рецидива и имеет большую прогностическую ценность, определяя новый критерий ремиссии.



Цель исследования: Детекция клональных перестроек генов иммуноглобулинов и Т-клеточных рецепторов у больных острым лимфобластным лейкозом и мониторинг минимальной резидуальной болезни с помощью пациент специфических праймеров в процессе лечения ОЛЛ.

Задачи исследования:

1. Оценить как частоту достижения полной и молекулярной ремиссии, так и долгосрочные результаты лечения больных при использовании новых протоколов дифференцированной терапии острых лимфобластных лейкозов.

2. Выделить молекулярные, клинико-лабораторные характеристики, которые определяют эффективность современной терапии острых лимфобластных лейкозов.

3. Создать высокочувствительные индивидуальные ПЦР-системы для выявления у больных острыми лимфобластными лейкозами клональных перестроек генов иммуноглобулинов 4. Определить частоту выявления и охарактеризовать спектр реаранжировок генов иммуноглобулинов и Т-клеточных рецепторов при острых лимфобластных лейкозах.

5. Оценить изменение объема опухолевой массы у больных острым лимфобластным лейкозом на разных этапах химиотерапии и трансплантации костного мозга, используя в качестве маркеров индивидуальные праймеры к уникальным областям клонально перестроенных генов иммуноглобулинов и Т клеточных рецепторов.

6. Разработать алгоритм мониторинга реаранжировок генов иммуноглобулинов и определить оптимальную частоту молекулярного обследования больных ОЛЛ.

Научная новизна:

1. Определена эффективность терапии острых лимфобластных лейкозов нового протокола «ОЛЛ-2005», основанного на определении чувствительности опухолевых клеток к преднизолону и модификации терапии в зависимости от этого критерия риска.

2. Охарактеризован спектр клональных перестроек генов иммуноглобулинов и Т клеточных рецепторов у взрослых больных острым лимфобластным лейкозом, определена высокая частота реаранжировок генов -цепей Т-клеточных рецепторов в исследуемой популяции больных.

3. Показано очень медленное уменьшение объема опухолевой массы, несмотря на мощные химиотерапевтические воздействия.

4. Показана персистенция минимальной резидуальной болезни до двух лет при сохранении клинико-гематологической ремиссии.

Практическая ценность:

1. Новый протокол терапии острых лимфобластных лейкозов «ОЛЛ-2005» используется в рамках многоцентровой кооперации.

2. Разработан метод выявления реаранжировок генов иммуноглобулинов, в результате которого созданы индивидуальные пациент-специфические праймеры для мониторинга минимальной резидуальной болезни у больных ОЛЛ.

3. Разработан алгоритм мониторинга минимальной резидуальной болезни.

4. Мониторинг минимальной резидуальной болезни при проведении унифицированного лечения больных острым лимфобластным лейкозом показал необходимость модификации терапии, что будет использовано при разработке новых протоколов.

Положения, выносимые на защиту:

1. Показана высокая эффективность программы «ОЛЛ-2005», позволившая достичь 88% полных ремиссий у больных из группы стандартного риска и 83% полных ремиссий у больных из группы высокого риска.

2. Чувствительность опухолевых клеток к глюкокортикостероидам является наиболее значимым среди прогностических факторов риска и влияет на долгосрочные результаты терапии.

3. Разработан метод выявления реаранжировок генов иммуноглобулинов и Т клеточного рецептора гамма у больных острым лимфобластным лейкозом.

Созданы индивидуальные тест-системы праймеров для мониторинга минимальной остаточной популяции опухолевых клеток.

4. Клональные реаранжировки генов тяжелых цепей иммуноглобулинов и -цепей Т-клеточных рецепторов выявляются у 88% больных острыми лимфобластными лейкозами.

5. При острых лимфобластных лейкозах наблюдается очень медленное уменьшение объема опухолевой массы, и молекулярная ремиссия достигается значительно позже клинико-гематологической ремиссии.

Публикации.

По теме диссертации опубликовано 4 печатные работы.

Апробация диссертации.

Основные положения работы доложены на Международной гематологической школе: "Лейкозы и лимфомы. Терапия и фундаментальные исследования" (Москва, 2006 г.), Всеросийском декаднике по гематологии (Москва, 2006 г.) Объем и структура работы.

Диссертация изложена на 144 страницах, состоит из введения, обзора литературы, методической главы, главы собственных исследований, заключения, выводов и списка литературы. Работа иллюстрирована 19 таблицами и рисунками. Диссертация выполнена в отделении высокодозной химиотерапии гемобластозов и трансплантации костного мозга ГНЦ РАМН (руководитель член корреспондент РАМН, проф. В.Г.Савченко), совместно с лабораторией генной инженерии ГНЦ РАМН (зав. к.б.н. А.В.Мисюрин, научный консультант В.Л.Сурин), а также при участии лаборатории кариологии ГНЦ РАМН (зав. проф.

Е.В.Домрачева), лаборатории функциональной морфологии гемобластозов ГНЦ РАМН (зав. проф. И.А.Воробьев), сотрудников других подразделений ГНЦ РАМН (директор академик РАМН и РАН А.И.Воробьев).

Соавторами работ, опубликованных по теме диссертации, являются д.м.н.

Е.Н.Паровичникова, проф. В.Г.Савченко, В.Л.Сурин, к.м.н. И.В.Гальцева, к.м.н.

И.А.Демидова, к.б.н. А.В.Мисюрин, проф. И.А.Воробьев, Е.А.Грецов, проф.

Л.С.Любимова, д.м.н. Л.П.Менделеева, проф. Е.В.Домрачева, к.м.н.

Ю.В.Ольшанская, к.м.н. О.А.Виноградова, к.м.н. В.Г.Исаев, к.м.н. Е.Н.Шуравина, к.м.н. М.А.Вернюк, Е.И.Желнова.

Содержание работы.

Характеристика больных.

В настоящей работе представлены результаты обследования и терапии больного с острым лимфобластным лейкозом, находившегося на лечении в отделении химиотерапии гемобластозов и трансплантации костного мозга (научный руководитель отделения – член-корр. РАМН проф. В.Г.Савченко) Гематологического Научного Центра (директор – академик РАМН и РАН А.И.Воробьев) с марта 2004г. по июнь 2006г.

В ГНЦ РАМН инициировано общее многоцентровое пилотное исследование по протоколу «ОЛЛ-2005» для больных старше 21 года. Для пациентов до 21 года был предусмотрен протокол терапии ОЛЛ у детей «Москва-Берлин 2002».

Пациентам с Ph+/bcr-abl ОЛЛ проводилась программа лечения ОЛЛ с Гливеком.

Терапию по протоколу «ОЛЛ-2005» проводили 20 больным, по протоколу «Ph+ОЛЛ с Гливеком» - 4 больным с Ph-позитивным ОЛЛ, по протоколу «ALL MB2002» - 7 больным в возрасте до 21 года.

В протоколе «ОЛЛ-2005» был сохранен принцип дифференцированного лечения пациентов в зависимости от обнаружения различных факторов риска.

Кроме того, всем больным выполнялось морфологическое исследование пунктата костного мозга на 7 день предфазы, и в случае обнаружения более 25% бластных клеток в период индукционного и консолидирующего курсов химиотерапии преднизолон заменяли на дексаметазон.

У больных, которым проводилась терапия по протоколу «ОЛЛ-2005», медиана возраста составила 26 лет. В группу стандартного риска включено больных (40%), в группу высокого риска 12 больных (60%). При иммунофенотипической диагностике у 15 больных выявлен В-линейный ОЛЛ и у больных – Т-линейный ОЛЛ. У 7 пациентов были выявлены нарушения кариотипа, которые были представлены клональными хромосомными перестройками.

Вторую группу исследования составили пациенты с Ph-позитивным ОЛЛ. Все пациенты были с впервые установленным Ph+/bcr-abl ОЛЛ, подтвержденным методами стандартной цитогенетики, D-FISH, ПЦР. Медиана возраста составила 58 лет. При иммунофенотипировании бластных клеток костного мозга у всех больных был выявлен В-линейный ОЛЛ. Методом стандартного цитогенетического исследования костного мозга транслокация t(9;

22) обнаружена только у 2 больных, методом D-FISH химерный ген bcr-abl выявлен у всех больных. Методом ПЦР химерный онкоген bcr-abl определен у 3 больных.

Третью группу исследования составили больные, которым проводилась терапия по протоколу лечения ОЛЛ у детей и подростков «ALL-MB2002». Медиана возраста составила 17 лет. При иммунофенотипической диагностике у 6 из больных выявлен В-линейный ОЛЛ. У 3 пациентов были выявлены нарушения кариотипа.

Детекция реаранжировки генов IgH и TCRG выполнена у 27 пациентов из 31:

у 17 больных, которым проводили терапию по протоколу «ОЛЛ-2005»;

у больных, которым проводили терапию по протоколу «Ph+ОЛЛ с Гливеком»;

у больных, которым проводили терапию по протоколу «ALL-MB2002».

Дополнительно молекулярное исследование с целью детекции реаранжировки генов IgH и TCRG было выполнено еще у 7 больных ОЛЛ, не вошедших в исследовательские протоколы.





Методы исследования.

Цитогенетическое исследование клеток костного мозга (стандартное и методом D-FISH) проводили в лаборатории кариологии ГНЦ РАМН (зав. д.м.н., проф. Е.В. Домрачева). Молекулярно-генетическое исследование костного мозга и периферической крови методом ОТ-ПЦР выполняли в лаборатории генной инженерии ГНЦ РАМН (зав. к.б.н. А.В. Мисюрин).

Для детекции и мониторинга клонально перестроенных генов вариабельного региона тяжелых цепей иммуноглобулинов (IgH) использовался метод двойной ПЦР-амплификации, Т-клеточного рецептора гамма (TCRG) – одноэтапная ПЦР амплификация. С этой целью исследовали образцы костного мозга в момент установления диагноза ОЛЛ и на различных этапах лечения.

Полимеразная цепная реакция с семейств-специфичными праймерами.

Для повышения надежности результатов исследования использовали системы праймеров. Праймеры VHL1-6 гомологичны консервативным участкам лидерной области (L) вариабельного региона. Праймеры VHD1-6 комплементарны первому структурному региону (FWR1). Структура праймеров, использованных в исследовании для амплификации VH-генов, приведена в таблице 1, для амплификации VG-генов - в таблице 2. Условия ПЦР для детекции реаранжировки генов IgH: тепловая денатурация 94С – 1 мин, отжиг праймеров 64С – 1 мин, синтез ДНК 72С – 1 мин, 35 циклов. Условия ПЦР для детекции реаранжировки генов TCRG: тепловая денатурация 95С – 1 мин, отжиг праймеров 62С – 1 мин, синтез ДНК 72С – 1 мин, 40 циклов.

Таблица 1. Нуклеотидные последовательности праймеров для детекции клонально перестроенных вариабельных регионов IgH.

Праймер Последовательность (5 3) JH ACCTGAGGAGACGGTGACCAGGGT VHL1/7 CTCACCATGGACTGGACCTGGAG VHL2 ATGGACACACTTTGCT(A/C)CAC VHL3 CCATGGAGTTTGGGCTGAGC VHL4 ACATGAAACACCTGTGGTTCTT VHL5 ATGGGGTCAACCGCCATCCT VHL6 ATGTCTGTCTCCTTCCTCAT VHD1 CCTCAGTGAAGGTCTCCTGCAAGG VHD2 TCCTGCGCTGGTGAAAGCCACACA VHD3 GGTCCCTGAGACTCTCCTGTGCA VHD4a TCGGAGACCCTGTCCCTCACCTGCA VHD4b CGCTGTCTCTGGTTACTCCATCAG VHD5 GAAAAAGCCCGGGGAGTCTCTGAA VHD6 CCTGTGCCATCTCCGGGGACAGTG Таблица 2. Нуклеотидные последовательности праймеров для детекции клонально перестроенных вариабельных регионов TCRG.

Праймер Последовательность (5 3) JG1.1/2.1 TTACCAGGCGAAGTTACTATGAGC JG1.3/2.3 GTGTTGTTCCACTGCCAAAGAG VG.1-8 GGAAGGCCCCACAGCTTCTT VG.9 CGGCACTGTCAGAAAGGAATC VG.10 AGCATGGGTAAGACAAGCAA VG.11 CTTCCACTTCCACTTTGAAA Первичную структуру ПЦР-фрагментов определяли с использованием концевых праймеров. Секвенирование проводили в ЦКП “Геном“ ИМБ РАН с помощью набора реактивов ABI PRISM®BigDyeTMTerminator v.3.1 с последующим анализом продуктов реакции на автоматическом секвенаторе ДНК ABI PRISM 3100-Avant.

Синтез пациент-специфичных праймеров.

После определения нуклеотидной последовательности ПЦР-фрагмента проводили его сравнение с герминальными V-генами IgH и TCRG с помощью программ IgBLAST и BLASTN. На основании полученных нуклеотидных последовательностей клонально перестроенных регионов производился подбор индивидуальных пациент-специфичных праймеров. Обратный праймер подбирали к уникальной для выявленного клона области CDR3, прямой праймер – к участкам V-области, наиболее специфичным для данного конкретного сегмента.

ПЦР с пациент-специфичными праймерами.

Определение уровня МРБ выполнялось полуколичественной ПЦР. В случае мониторинга МРБ по реаранжировке генов IgH ПЦР амплификацию проводили в две стадии с двумя парами праймеров ("гнездовая" ПЦР) для повышения чувствительности. В случае мониторинга МРБ по реаранжировке генов TCRG ПЦР амплификацию проводили в одну стадию с соответствующим семейств специфичным праймером VG и индивидуальным пациент-специфичным праймером.

Статистическую обработку полученных данных проводили методом четырехпольных таблиц с использованием Критерия Х2. Эффективность лечения оценивалась посредством построения кривых общей и безрецидивной выживаемости с использованием метода Каплан-Майер.

Основные понятия:

Полная клинико-гематологическая ремиссия – состояние кроветворной ткани, при котором в пунктате костного мозга обнаруживается 5% и менее бластных клеток при нормальном соотношении всех ростков кроветворения, при количестве нейтрофилов в периферической крови 1,5х109/л, тромбоцитов более или равном 100х109/л и отсутствии экстрамедуллярных очагов лейкемического роста. Указанные показатели должны сохраняться в стабильном состоянии в течение 1 месяца и более.

Молекулярная ремиссия – это полная клинико-гематологическая ремиссия острого лейкоза при отсутствии исходно определявшихся молекулярных маркеров методом ПЦР с чувствительностью 10-4.

Минимальная резидуальная болезнь – постоянно определяемая остаточная популяция опухолевых клеток, выявить которую можно лишь с помощью новых высокочувствительных молекулярно-генетических методов. Одновременно при световой микроскопии в костном мозге определяется не более 5% бластных клеток при нормальных показателях периферической крови и отсутствии экстрамедуллярных очагов.

Рецидив острого лейкоза – выявление в пунктате костного мозга более 5% бластных клеток. Если в пунктате костного мозга не более 10% бластных клеток при нормальном анализе гемограммы, проводилось повторное исследование костного мозга через 7-10 дней. Если в пунктате сохранялось 5% бластных клеток и более, то констатировали рецидив основного заболевания (ранний рецидив – при констатации в течение 12 мес. от момента достижения ремиссии, поздний считали через 12 мес. и более от момента достижения ремиссии).

Общая выживаемость – число реально оставшихся в живых больных ОЛ на фоне проведенной терапии. Для построения кривой общей выживаемости анализируют временные параметры всех больных, включенных в исследование.

Точкой отсчета является день начала терапии. Событием считается только смерть больного от любой причины и на кривой отображается ступенькой, идущей вниз. Больных, живых во время проведения анализа, расценивают как случай и отмечают на кривой черточкой, т.е. цензурируют. Больных, судьба которых неизвестна, цензурируют в тот момент, когда было известно, что они живы.

Больных, отказавшихся от лечения, цензурируют в день отказа от терапии.

Безрецидивная выживаемость – выживаемость только тех больных, у которых была достигнута ремиссия основного заболевания. Точкой отсчета считается дата достижения ремиссии. Событиями считаются рецидив или смерть от любой причины. Цензурируют только тех больных, которые были живы и находились в полной ремиссии в момент проведения анализа. Больных, судьба которых неизвестна, цензурируют в тот момент, когда было известно, что они живы в полной ремиссии. Больных, у которых была достигнута полная ремиссия, но они отказались от лечения в ремиссии, цензурируют в день отказа от терапии.

Опухолевый клон – генетически однородная популяция лейкозных клеток, возникшая из единичной трансформированной клетки-предшественницы. При эволюции моноклональной популяции опухолевые клетки приобретают дополнительные генетические изменения, в частности разные перестройки IgH и TCR, и определяются как субклоны.

Олигоклональность – наличие нескольких специфических маркеров в лейкозной популяции при детекции реаранжировок генов Ig и TCR.

Результаты исследования.

Результаты лечения больных ОЛЛ по протоколу «ОЛЛ-2005».

С 2005 года в ГНЦ РАМН инициировано общее многоцентровое пилотное исследование по протоколу «ОЛЛ-2005». В настоящей работе представлены результаты обследования и терапии 20 больных с острым лимфобластным лейкозом, находившихся в отделении химиотерапии гемобластозов и трансплантации костного мозга ГНЦ РАМН с марта 2004 г. по июнь 2006 г.

Цитогенетическое исследование костного мозга и определение иммунофенотипа лейкемических клеток были обязательными условиями включения. На лечение по протоколу принимались только больные ОЛЛ с отсутствием транслокации (9;

22) или химерного гена bcr/abl. К группе высокого риска были отнесены пациенты с исходным лейкоцитозом более 30х109/л для В-линейных ОЛЛ и более 100х109/л для Т-ОЛЛ, уровнем ЛДГ более 960 ЕД, с ранним пре-В ОЛЛ и ранним Т-ОЛЛ.

Затем группа риска пересматривалась на 7-ой день предфазы: больные, у которых определялось более 25% бластных клеток в костном мозге на 7-ой день глюкокортикостероидной терапии, были переведены на программу лечения с дексаметазоном и включены в группу высокого риска. Также группа риска пересматривалась после проведения индукции: больные, у которых ремиссия не была достигнута после проведения I фазы индукции, были переведены на программу терапии, предусмотренную для больных из группы высокого риска.

Общие результаты терапии острых лимфобластных лейкозов представлены в таблице 3.

Таблица 3. Результаты индукционной терапии у первичных больных с ОЛЛ.

Показатели Стандартный риск Высокий риск Всего n=8 (40%) n=12 (60%) n= 25% бластных клеток 6 / 8 (75%) 6 / 9 (67%) 12 / 17** (71%) на 7 день предфазы * Полная ремиссия (ПР) 7 (88%) 10 (83%) 17 (85%) Резистентность 1 (12%) 0 1 (5%) Ранняя летальность 0 2 (17%) 2 (10%) Смерть в ремиссии 1 (12%) 0 1 (5%) Примечание: * - определение бластных клеток в костном мозге. ** исследование костного мозга на 7-ой день предфазы было выполнено только пациентам.

При рассмотрении результатов выявлен высокий процент достижения ремиссии у больных как из группы стандартного риска (88%), так и из группы высокого риска (83%). У большинства больных отмечалась низкая чувствительность ОЛЛ к глюкокортикостероидной терапии, установленная на основании результатов морфологического исследования костного мозга на 7-ой день предфазы, что требовало смены терапии преднизолоном на дексаметазон.

Поскольку в данном исследовании сохраняющийся бластоз в костном мозге более 25% после предфазы являлся фактором риска, то эти пациенты были переведены в группу высокого риска, если они исходно в нее не входили. Таким образом, после завершения предфазы в группу высокого риска включено 18 из 20 больных (90%). Использование глюкокортикоидных гормонов является ключевым фактором в лечении ОЛЛ. Чувствительность опухолевых клеток ОЛЛ к преднизолону, определяемая путем подсчета бластных клеток в периферической крови или костном мозге на 7-ой день терапии этим препаратом, является веским фактором риска [Annino L., Blood, 2002. Schrappe M, Blood, 2000]. Так, если на 7-ой день лечения в костном мозге выявляется более 25% бластных клеток, то это определяет группу высокого риска [Seibel N., Blood, 2003]. Кроме того, чувствительность к преднизолону явилась тем независимым фактором прогноза, который оказывал влияние на вероятность достижения ремиссии. В итальянском исследовании процент достижения полной ремиссии при чувствительности к преднизолону составил 87%, при отсутствии чувствительности – 70% [Annino L., Blood, 2002].

При анализе долгосрочных результатов терапии необходимо оценивать такие показатели как общая и безрецидивная выживаемость у больных различных групп риска. Общая выживаемость у больных, которым проводилась терапия по протоколу «ОЛЛ-2005», составила 70% при сроке наблюдения 27 месяцев. Общая выживаемость у больных групп стандартного и высокого риска, присвоенных до начала лечения по исходным показателям, не различается. Однако если рассматривать общую выживаемость у больных в зависимости от процента бластных клеток в костном мозге на 7-ой день предфазы, то определяются четкие различия (рисунок 1).

Рисунок 1. Общая выживаемость по протоколу «ОЛЛ-2005» в зависимости от процента бластных клеток на 7-ой день предфазы.

в е, р о я, т н, о с т, ь месяцы 0 5 10 15 20 25 1 - больные, у которых определялось менее 25% бластных клеток в КМ после предфазы 2 - больные, у которых определялось более 25% бластных клеток в КМ после предфазы Из рисунка 1 видно, что такой фактор прогноза как чувствительность опухолевых клеток к ГКС терапии действительно влияет на показатели выживаемости больных ОЛЛ. На 7-ой день предфазы преднизолоном у 12 из больных (71%) определялось более 25% бластных клеток в КМ: 6 из них изначально были включены в группу стандартного риска, 6 – в группу высокого риска. Из этого следует, что, несмотря на исходные критерии риска, острые лимфобластные лейкозы характеризуются еще более четким дискриминирующим признаком – чувствительностью опухолевых клеток к ГКС.

Безрецидивная выживаемость в течение 26 месяцев составила 40%, а вероятность сохранения полной ремиссии – 50%. Медиана продолжительности полной ремиссии у всех больных ОЛЛ, лечившихся по программе «ОЛЛ-2005», составила 23 месяца. Частота развития рецидивов у больных в зависимости от группы риска, не различалась. Вероятность развития рецидива в исследуемых группах составила 50% для больных с менее 25% бластных клеток на 7-ой день ГКС терапии и 40% для больных с более 25% бластных клеток на 7-ой день ГКС терапии. Итальянскими исследователями продемонстрировано влияние чувствительности опухолевых клеток к преднизолону на долгосрочные результаты: общая выживаемость при чувствительности бластных клеток к преднизолону составила 33%, при отсутствии – 17%;

безрецидивная выживаемость при чувствительности опухолевых клеток – 32%, а при ее отсутствии – 22% [Annino L., Blood, 2002].

Результаты лечения больных ОЛЛ по протоколу «Ph+ОЛЛ с Гливеком».

С 2004 года в ГНЦ РАМН инициировано новое исследование по лечению больных ОЛЛ, у которых выявляется транслокация t(9;

22) методами стандартной цитогенетики и D-FISH, а также химерный транскрипт bcr-abl. Основной целью пилотного многоцентрового исследования стала оценка эффективности и токсичности Гливека при его одновременном использовании с химиотерапией (индукция, консолидация) у больных с Ph-позитивным ОЛЛ. Параллельно предполагалось осуществление молекулярного и цитогенетического мониторинга у всех пациентов. В настоящей работе представлены результаты обследования и терапии всего 4 больных с Ph-позитивным острым лимфобластным лейкозом.

Методом стандартного цитогенетического исследования костного мозга транслокация t(9;

22) была обнаружена у 2 из 4 больных, методом D-FISH химерный ген bcr-abl выявлен у всех 4 больных. Методом ПЦР химерный онкоген bcr-abl определен у 3 больных: у 1 больного – транскрипт p190, у 1 больного – p210 и у 1 больного – p190 и p210 одновременно. Клинико-гематологическая ремиссия была достигнута у 3 больных, молекулярная ремиссия – у 2 больных.

Резистентная форма ОЛЛ не была отмечена ни у одного больного, однако больной умер при проведении индукционной терапии. У 1 больного была зарегистрирована смерть в ремиссии. Причиной обеих смертей явились тяжелые инфекционные осложнения. Для анализа долгосрочных результатов исследуемая группа больных очень мала. Двое из 3 больных, у которых достигнута ремиссия, живы без признаков рецидива в течение 10 и 12 месяцев, соответственно.

Результаты лечения больных ОЛЛ по протоколу «ALL-МВ2002».

В настоящей работе представлены результаты обследования и терапии больных с ОЛЛ, находившихся в отделении химиотерапии гемобластозов и трансплантации костного мозга ГНЦ РАМН, которым проводилась терапия по программе «ALL-MB-2002».

В результате индукционной терапии по программе «ALL-MB2002» у всех подростков была достигнута полная ремиссия. Хотя группа больных очень мала, можно видеть, что программа терапии «ALL-MB2002» действительно является эффективной и менее токсичной по сравнению с протоколами терапии ОЛЛ у взрослых, о чем свидетельствует отсутствие больных с резистентными формами ОЛЛ, а также ранней летальности и смерти в ремиссии. Хотелось бы отметить высокий процент больных с низкой чувствительностью к ГКС терапии – 57% (4 из 7 больных).

Анализ долгосрочных результатов терапии в исследуемой группе показал 100% общую выживаемость при сроке наблюдения 21 месяц. Живы без признаков рецидива 6 из 7 больных. Безрецидивная выживаемость в течение 20 месяцев составила 79%. Долгосрочные результаты у подростков с ОЛЛ значительно лучше в сравнении с долгосрочными результатами у взрослых больных с ОЛЛ: 100% общая выживаемость против 70% общей выживаемости у взрослых, 79% безрецидивная выживаемость против 40% безрецидивной выживаемости у взрослых больных в течение 2 лет.

Результаты детекции реаранжировок генов IgH и TCRG у больных ОЛЛ.

В настоящее исследование включено 34 больных ОЛЛ. У 27 из 34 больных (79%) установлен В-клеточный ОЛЛ: у 26 – острый лимфобластный лейкоз из предшественников В-клеток и у 1 – В-зрелый острый лимфобластный лейкоз. У из 34 больных (21%) установлен Т-клеточный ОЛЛ. В таблице 4 представлены результаты детекции реаранжировок генов IgH и TCRG при исследовании КМ методом ПЦР с семейств-специфичными праймерами в дебюте заболевания.

Таблица 4. Выявление реаранжировок генов IgH и TCRG у больных ОЛЛ при первичном обследовании.

маркеры В-ОЛЛ, n=27 Т-ОЛЛ, n=7 Всего, n= 5 (18%) 0 5 (15%) только IgH 4 (15%) 6 (86%) 10 (29%) только TCRG 15 (56%) 0 15 (44%) IgH + TCRG нет маркеров 3 (11%) 1 (14%) 4 (12%) Как видно из приведенных данных, у большинства больных выявляются реаранжировки генов и IgH и TCRG – 44% (15 из 34 больных). Реаранжировки генов Т-клеточных рецепторов выявляются у 73% больных (25 из 34 больных), при этом как у больных с Т-клеточным ОЛЛ – 86% (6 из 7 больных), так и у больных с В-клеточным ОЛЛ – 71% (19 из 27 больных). Реаранжировки генов IgH выявляются у 59% больных (20 из 34 больных), и только с В-клеточным ОЛЛ.

Перестройки генов Ig и TCR могут встречаться при различных иммунологических вариантах ОЛЛ.

Наличие кросс-линейных реаранжировок IgH и TCR в опухолевых клетках при ОЛЛ увеличивает количество мишеней для определения клональности и МРБ.

Так, в дебюте ОЛЛ при исследовании бластных клеток можно выявить несколько клональных перестроек генов Ig и/или TCR. При эволюции исходной моноклональной популяции опухолевых клеток, некоторые из них приобретают новые генетические изменения, которые могут быть связаны как с прогрессией опухоли, так и отражать определенные этапы дифференцировки. Так, при дифференцировке лимфоцитов происходит перестройка генома. В данном случае опухолевые клетки, характеризующиеся разными перестройками IgH и TCR, определяются как субклоны. Наличие нескольких специфических маркеров в лейкозной популяции называется олигоклональностью. При детекции реаранжировок генов IgH и TCRG в настоящей работе у большинства больных выявлены 2 и более специфических маркеров: у 17 из 30 больных (57%) – маркера, у 3 из 30 больных (10%) – 3 маркера и у 2 из 30 больных (6%) – маркера. Только один маркер для мониторинга МРБ выявлен у 8 из 30 больных (27%). При мониторинге МРБ очень важно наличие 2 и более маркеров, так как во время лечения острого лейкоза динамика опухолевых субклонов различна.

Использование двух и более специфических маркеров позволяет существенно снизить вероятность получения ложноотрицательных результатов при повторных исследованиях образцов костного мозга больного.

Установлено, что для острого лимфобластного лейкоза характерна некоторая избирательность реаранжировок генных сегментов, отличная от случайного выбора, характерного для нормальной дифференцировки В лимфоцитов. Наиболее часто реаранжировки у больных с ОЛЛ происходят с участием VH-сегментов 3-го семейства – 16 IgH генов. Преобладание VH3 сегментов в клонально перестроенных IgH при В-линейном ОЛЛ обусловлено наибольшей представленностью этого семейства среди реаранжирующихся VH генов: из 65 VH3-сегментов - 27 реаранжирующихся [Coyle L., Br J Haemotology, 1996]. В данном случае частота реаранжирующихся VH3 сегментов при ОЛЛ в основном соответствует нормальному репертуару В-лимфоцитов. У 2 из больных (10%) были выявлены перестройки с участием VH6-1 сегмента – единственного представителя VH6-семейства. Европейскими исследователями также отмечено достоверно повышенное участие VH6-сегмента в реаранжировках генов IgH при В-линейном ОЛЛ у детей и взрослых: 16,7% и 11,0% соответственно. Частота реаранжировки VH6-сегмента у здоровых доноров составляет 0,6%. Исследователи связывают описанный феномен при ОЛЛ с проксимальным расположением этого сегмента по отношению к точке соединения и участием в реаранжировке в первую очередь [Hoffbrand V., Blood, 2001]. Если рассматривать все найденные перестройки VH-генных сегментов, учитывая их расположение по отношению к точке соединения, то видно, что большинство реаранжирующихся VH-сегментов находятся в области проксимальной к локусу DJ. Для острых лимфобластных лейкозов также характерна отличная от случайного выбора перестройка DH сегментов. У большинства больных были выявлены реаранжировки гена IgH с участием DH2-2 сегмента: у 7 из 20 больных.

Частота обнаружения DH2-2 сегмента составляет 30% (8 из 27 прочитанных нуклеотидных последовательностей DH генных сегментов). По данным литературы у больных ОЛЛ также самым часто выявляемым DH-сегментом является DH2-2 [Li A., Blood, 2004]. Частота выявления реаранжировок генов IgH с семейством DH2 является самой высокой как по отношению к другим семействам в перестроенных генах у больных ОЛЛ, так и в сравнении с перестройками генов в репертуаре нормальных В-лимфоцитов, и составляет 35% по литературным данным и 42% в нашем исследовании. Напротив, семейство DH6 генов чаще выявляется в перестроенных генах IgH нормальных В-лимфоцитов (23% против 7%). В нашем исследовании показано также, что у больных ОЛЛ в клональных перестройках генов IgH в большинстве случаев задействованы сегменты JH (33%), JH5 (25%) и JH6 (33%). По литературным данным в реаранжированных генах IgH наиболее часто встречается JH4-сегмент (34%) [Li A., Blood, 2004].

Помимо избирательности реаранжировок генных сегментов IgH, для ОЛЛ также характерна отличная от случайного выбора перестройка VG-сегментов генов TCRG. Наибольшее участие в реаранжированных генах TCRG определено для VG2 и VG9 семейств: у 9 и у 10 больных, соответственно. Необходимо отметить, что в настоящее время зависимость эффективности терапии больных ОЛЛ от выявляемого спектра генных сегментов, участвующих в реаранжировках генов Ig и TCR, не выявлена.

Анализ приведенных результатов детекции реаранжировок генов IgH и TCRG показал, что:

- у большинства больных ОЛЛ (88%) в дебюте заболевания выявляются реаранжировки генов IgH и/или TCRG, - реаранжировки генов TCRG встречаются при различных иммунологических вариантах ОЛЛ: как у больных с Т-линейным ОЛЛ (86%), так и у больных с В-линейным ОЛЛ (71%), - кросс-линейные перестройки генов TCR при В-клеточном ОЛЛ связаны с уровнем дифференцировки опухолевых В-клеток и обнаруживаются в 40% случаев при раннем пре-В ОЛЛ, в 78% случаев при общем пре-В ОЛЛ и в 91% случаев при пре-В ОЛЛ, - у больных с ОЛЛ часто обнаруживаются несколько клональных перестроек IgH и/или TCR: у 73% больных в дебюте заболевания определяются 2 и более субклонов, - в отличие от опухолевых заболеваний, возникающих из зрелых клеток, при ОЛЛ в реаранжированных генах IgH чаще определяются VH-сегменты с проксимальным расположением к DJ локусу и DH-сегменты с дистальным расположением к JH локусу, - для ОЛЛ характерна избирательность реаранжировок VH, DH, JH и VG генных сегментов, спектр которых отличается от репертуара нормальных В лимфоцитов.

Мониторинг минимальной резидуальной болезни.

Выполнен мониторинг МРБ методом ПЦР с пациент-специфичными праймерами в период индукции, консолидации и поддерживающего лечения больным. В работе представлено динамическое исследование реаранжировок генов IgH у 16 больных ОЛЛ. Дополнительно, был выполнен мониторинг реаранжировок генов TCRG у 7 больных ОЛЛ. Четверым из 19 больных проводился параллельный мониторинг перестроек генов IgH и TCRG.

Для анализа мы суммировали результаты мониторинга МРБ у 18 больных ОЛЛ, которым проводили лечение по протоколам «01.1995», «ОЛЛ-2005» и «ALL MB2002». Мониторинг МРБ у больного с В-зрелоклеточным ОЛЛ представлен отдельно. Включенные в исследование 18 больных были как из группы стандартного риска, так и из группы высокого риска. На разных этапах терапии оценивались результаты исследования у разного числа больных. При выявлении у одного больного исходно нескольких опухолевых субклонов, наличие МРБ определялось в случае обнаружения хотя бы одной из первоначальных реаранжировок генов. Медиана наблюдения за больными составила 8 месяцев (разброс 1-23 месяца). У 18 из 19 больных была достигнута клинико гематологическая ремиссия. Результаты мониторинга МРБ у 18 больных ОЛЛ представлены в соответствии с частотой выявления клональных реаранжировок генов на разных этапах терапии (рисунок 2).

Рисунок 2. Частота выявления маркеров МРБ у больных ОЛЛ на разных этапах терапии.

п р о ц 50 нет е есть н т однократно ы (%) п/I п/I по п/к п/п ф.и Iф. дд он ре ер ин со дф нд ж.

ли ду укц азы кци да ии ци и и Примечание: «нет» - реаранжировки генов не выявлялись;

«есть» реаранжировки генов выявлялись;

«однократно» - во время проведения поддерживающей терапии реаранжировки генов выявлялись однократно;

п/предфазы – исследование выполнялось после 7 дней ГКС терапии;

п/Iф.индукции – исследование выполнялось после I фазы индукции ремиссии по протоколу «ОЛЛ-2005» (1-1,5 мес.) и после основной фазы индукции ремиссии по протоколу «ALL-MB2002» (1 мес.);

п/IIф.индукции – исследование выполнялось после II фазы индукции по протоколу «ОЛЛ-2005» (2-4 мес.);

п/консолидации – исследование выполнялось после консолидации ремиссии (4-9 мес.);

поддерж. – исследование выполнялось на разных этапах поддерживающей терапии.

МРБ сохранялась у 100% больных после предфазы, у 94% больных после I фазы индукции ремиссии, у 70% больных после II фазы индукции. Важно отметить, что динамика регрессии маркеров опухолевого клона у больных ОЛЛ очень длительная. Только после консолидирующего лечения у 64% больных (9 из 14 больных) маркеры МРБ не обнаруживались. Кроме того, на протяжении всей поддерживающей терапии у 2 из 10 (20%) больных реаранжировки генов стойко выявлялись. У обоих больных впоследствии были констатированы рецидивы ОЛЛ на 15 и 24 месяцах терапии. Также вскоре после консолидирующего лечения рецидив ОЛЛ был зарегистрирован у больного, у которого на протяжении всей терапии сохранялись маркеры опухолевого клона. Таким образом, у всех больных, у которых на протяжении всего лечения определялась МРБ, развились рецидивы. У больных, у которых МРБ на фоне поддерживающей терапии определялась однократно, не было зарегистрировано рецидивов. Рецидивы также развились у 2 больных, у которых МРБ определялась только после 1 месяца лечения, а после 11 недели терапии не выявлялась на протяжении всего наблюдения. Немецкие авторы, анализируя значимость МРБ у взрослых больных ОЛЛ, продемонстрировали длительную персистенцию опухолевого клона с реаранжировками генов IgH и TCR: 88% случаев на ранних этапах индукционной терапии и 13% - на 52 неделе лечения. Также выявлена зависимость между МРБ позитивностью на ранних этапах лечения и риском развития рецидива [Bruggemann M., Blood, 2006]. Mortuza F. и коллеги продемонстрировали долгосрочные результаты для 85 больных с В-линейным ОЛЛ. У больных с выявляемой МРБ на сроках лечения 3-5 месяцев и 6-9 месяцев безрецидивная выживаемость составила 11% и 0%, соответственно. Напротив, у больных, у которых на этих же сроках терапии реаранжировки генов не определялись, безрецидивная выживаемость была значительно выше – 74% и 80%, соответственно [Mortuza F., J Clin Oncol., 2002].

Таким образом, в ГНЦ РАМН разработан метод ПЦР с использованием индивидуальных пациент-специфичных праймеров, с помощью которого больным ОЛЛ проводится динамическое исследование реаранжировок генов IgH и TCRG.

Анализ приведенных результатов мониторинга МРБ показал, что:

- при мониторинге реаранжировок генов IgH чувствительность метода двухэтапной ПЦР с пациент-специфичными праймерами составляет 10-4, - при мониторинге реаранжировок генов TCRG чувствительность метода ПЦР с пациент-специфичными праймерами составляет 10-2 -10- - мониторинг МРБ желательно проводить с помощью 2 и более маркеров, так как динамика опухолевых субклонов под цитостатическим воздействием может быть разной, - молекулярная ремиссия у больных ОЛЛ достигается позже клинико гематологической, - минимальная резидуальная болезнь может сохраняться длительное время, несмотря на мощные химиотерапевтические воздействия, - исследование МРБ оптимально выполнять на следующих этапах терапии:

после индукционной терапии, после консолидации ремиссии, каждые 2- месяца на фоне поддерживающей терапии и после снятия с лечения, - мониторинг МРБ выявляет больных с высоким риском развития рецидива, но наличие остаточного лейкемического пула клеток не всегда является признаком грядущего рецидива, - отсутствие МРБ, даже на ранних этапах, не означает отсутствие вероятности развития рецидива и не является поводом для преждевременного окончания терапии, - при однократном обнаружении маркеров МРБ у больных в полной ремиссии необходимо повторное молекулярное исследование костного мозга.

Заключение.

Совершенно очевидно, что эффективность лечения острых лимфобластных лейкозов зависит от прецизионности и адекватности химиотерапевтического воздействия, которые в свою очередь определяются биологическими характеристиками опухолевого процесса. Исходное выделение факторов риска позволяет с самого начала выбрать необходимую терапевтическую тактику. К значимым прогностическим признакам, обусловливающим неблагоприятные результаты лечения при острых лимфобластных лейкозах, которые были рассмотрены в нашем исследовании, относят возраст больных, чувствительность опухолевых клеток к глюкокортикостероидам на 7-ой день предфазы, наличие транслокации t(9;

22) и обнаружение минимальной резидуальной болезни в процессе лечения. Давно известно, что с увеличением возраста снижаются частота достижения полных ремиссий и показатели безрецидивной выживаемости. Так, в немецком исследовании показано, что с каждым увеличением возраста на 5 лет отмечается снижение уровня 5-летней выживаемости приблизительно на 10% [Nachman J., Hematology, 1999]. Также одним из значимых факторов прогноза является чувствительность бластных клеток при ОЛЛ к глюкокортикоидным гормонам. В настоящей работе у 28 из больных, которым проводилась химиотерапии по трем протоколам («ОЛЛ-2005», «Ph+ОЛЛ с гливеком» и «ALL-MB2002»), было выполнено исследование костного мозга после предфазы. Более 25% бластных клеток в КМ определялось у 7 из больных (64%) моложе 21 года и у 12 из 17 больных (71%) старше 21 года. Как видно из представленных данных, число подростков и взрослых больных с низкой чувствительностью опухолевых клеток ОЛЛ сопоставимо. Необходимо отметить, что этот показатель у подростков превышает таковой у детей с ОЛЛ. У детей процент ОЛЛ с низкой чувствительностью бластных клеток к преднизолону невелик – 8-10% [Schrappe M., Blood, 2000]. Это еще раз подтверждает биологические различия между ОЛЛ у подростков и у детей. Одним из важных прогностических признаков также является обнаружение определенных изменений кариотипа опухолевых клеток. К неблагоприятным цитогенетическим признакам отнесена транслокация t(9;

22). Результаты лечения этой формы ОЛЛ крайне неудовлетворительны. В нашем исследовании у 3 из 4 больных с Ph позитивным ОЛЛ была достигнута клинико-гематологическая ремиссия, при этом у 2 из них, в том числе и молекулярная ремиссия. По данным Ottmann O.G. и соавторов использование ингибитора abl-тирозинкиназы позволяет достичь клинико-гематологической ремиссии у 90% больных, молекулярной ремиссии – у 60% [Ottmann O., Blood, 2002].

Суммируя все данные по терапии ОЛЛ в ГНЦ РАМН, следует отметить, что программы терапии ОЛЛ для взрослых «ОЛЛ-2005», для подростков «ALL MB2002» и для больных с t(9;

22) «Ph+ОЛЛ с Гливеком» являются достаточно эффективными. Общая и безрецидивная выживаемость для взрослых больных ОЛЛ, получавших терапию по протоколу «ОЛЛ-2005», составила 70% и 40%, а для подростков с ОЛЛ, получавших терапию по протоколу «ALL-MB2002», составила 100% и 79%, соответственно. В нашем исследовании показана прогностическая ценность определения чувствительности опухолевых клеток к ГКС, что является значимым при рассмотрении долгосрочных результатов. Общая выживаемость у больных ОЛЛ, у которых после предфазы преднизолоном в костном мозге определялось менее 25% бластных клеток, составила 100%. Напротив, общая выживаемость у больных с плохим ответом на преднизолон составила 70%.

Различий в показателях безрецидивной выживаемости у больных в этих исследуемых группах не получено. Это, по-видимому, связано с тем, что не всем больным после определения более 25 % бластных клеток в костном мозге на 7-ой день предфазы преднизолон заменяли на дексаметазон. Таким образом, в модифицированном протоколе «ОЛЛ-2005» предусмотрена смена ГКС в индукции ремиссии и постремиссионой терапии в зависимости от процента опухолевых клеток после предфазы.

Исключительно важными для определения прогноза заболевания являются также детекция и мониторинг минимальной резидуальной болезни. Определение реаранжировок генов иммуноглобулинов и Т-клеточных рецепторов в дебюте заболевания и в процессе лечения, оценка эффективности терапевтического воздействия на молекулярном уровне стали целью нашего исследования.

В это исследование было включено 34 больных острыми лимфобластными лейкозами. Мониторинг реаранжировок генов IgH и TCRG осуществляли методом двухэтапной полимеразной цепной реакции с пациент-специфичными праймерами, индивидуальными для каждого больного. При проведении исследования костного мозга в дебюте заболевания методом ПЦР с семейств специфичными праймерами у 30 из 34 больных (88%) были выявлены реаранжировки генов IgH и/или TCRG. Клональные перестройки гена IgH были выявлены у 20 из 30 больных (67%). И у всех этих больных был установлен В клеточный ОЛЛ. Перестройки гена TCRG были выявлены у 25 из 30 больных (83%). Помимо высокой частоты реаранжировок гена TCRG при Т-ОЛЛ, выявлена высокая частота кросс-линейных перестроек этого локуса при В-линейном ОЛЛ.

Таким образом, реаранжировки генов IgH и TCRG являются оптимальными мишенями для определения клональности и минимальной резидуальной болезни.

Исследование нескольких локусов дает возможность увеличить число мишеней для мониторинга МРБ. В нашем исследовании у 22 из 30 больных (73%) в дебюте заболевания были выявлены 2 и более маркеров МРБ. По данным немецких исследователей частота выявления олигоклональности составила 52% [Bruggemann M., Blood, 2006]. Для мониторинга МРБ очень важно оценивать 2 и более маркеров, так как во время лечения ОЛЛ динамика опухолевых субклонов различна. Использование двух и более специфических маркеров позволяет существенно снизить вероятность получения ложноотрицательных результатов при повторных исследованиях образцов костного мозга больного.

В нашем исследовании проведен анализ спектра реаранжировок генных сегментов IgH и TCRG. Для ОЛЛ характерна избирательность использования VH, DH, JH генных сегментов, спектр которых отличается от репертуара нормальных В-лимфоцитов. Причины неравного использования VH-, D- и JH-генов в наивном репертуаре можно разделить на 2 группы. Первая состоит в селекции В-клеток, экспрессирующих определенные VH-гены. После того как созревающая клетка экспрессирует на своей поверхности IgM, ее судьба определяется сигналами, которые она получает через В-клеточный рецептор. Связывание с аутоантигенами на этом этапе может приводить к удалению В-клетки по механизму апоптоза или повторной перестройке генов IgH (рецепторное обучение) [Edry E., J of Immunology, 2004. Janeway C., “Immunobiology”, 2001]. Вторая причина неравного использования VH-, D- и JH-генов связана с исходно разной способностью герминальных VH- и DH-генов участвовать в перестройках. Существование неравных условий для участия в перестройках доказывается фактом предпочтительного использования определенных генов в непродуктивных перестройках [Rassenti L., J of Immunology, 1991. Wasserman R., J Clin Oncol, 1992]. Также, установлен аллельный полиморфизм VH-генов. Различия между аллельными вариантами по локусу Ig связаны в основном с наличием делеций или вставок [Sasso E., J Clin Invest, 1993]. Таким образом, наличие нескольких реаранжировок генов IgH у 1 больного может быть также обусловлено возможностью перестроек генов в одной клетке, но на разных аллелях.

При мониторинге МРБ у больных ОЛЛ выявлена длительная регрессия опухолевого клона и показано, что молекулярная ремиссия достигается существенно позже клинико-гематологической. Рецидивы были констатированы у 3 больных, у которых маркеры МРБ выявлялись постоянно на разных этапах терапии до констатации гематологического рецидива. Из тех больных, у которых маркеры МРБ регрессировали после консолидации ремиссии (2,5 месяца) и в дальнейшем не определялись (n=9), у 2 больных также развился рецидив ОЛЛ. У больных, у которых МРБ во время поддерживающей терапии выявлялась однократно, ни в одном случае не было констатировано рецидива ОЛЛ. Эти результаты свидетельствуют о том, что постоянное определение МРБ выявляет больных ОЛЛ с высоким риском развития рецидива. В то же время, отсутствие МРБ на ранних этапах терапии не всегда означает отсутствие вероятности развития рецидива. При однократном обнаружении маркеров МРБ у больных в полной ремиссии необходимо повторное молекулярное исследование костного мозга после проведенного курса химиотерапии. Европейские исследователи продемонстрировали сопоставимые с нашими результаты мониторинга МРБ у больных ОЛЛ. Так, из 105 больных, включенных в это исследование, у развился рецидив. У 17 из 22 больных маркеры МРБ определялись перед развитием рецидива, а у 5 из 22 больных МРБ не определялась. Медиана временного интервала между определением МРБ и развитием клинического рецидива составила 4,1 месяца [Raff T., Blood, 2006]. Таким образом, молекулярные исследования костного мозга целесообразно выполнять после основных этапов терапии (индукция, консолидация ремиссии, трансплантация костного мозга) и каждые 2-3 месяца во время поддерживающей терапии.

Вероятность развития рецидива у больных, у которых МРБ не определяется, требует дальнейшего поиска факторов риска и дополнительных исследований. У трех больных, у которых развился рецидив ОЛЛ, было проведено повторное молекулярное исследование всего спектра реаранжировок генов IgH и TCRG.

Найденные маркеры соответствовали таковым при дебюте заболевания. Однако следует отметить, что качественный состав маркеров МРБ при рецидиве может изменяться. Европейские исследователи оценили результаты анализа реаранжировок генов Ig и TCR у больных в первом и втором рецидивах ОЛЛ и показали, что из 149 реаранжировок генов Ig и TCR, выявленных в первом рецидиве ОЛЛ, только 109 (73%) обнаружены повторно во втором рецидиве [Guggemos L., Haematologica, 2003]. Проведенные исследования позволяют рекомендовать выполнение повторной детекции реаранжировок генов IgH и TCRG у больных ОЛЛ на более поздних этапах наблюдения для определения вероятности развития рецидива.

В заключение представляется важным подчеркнуть, что проведенное нами исследование по изучению биологических особенностей острых лимфобластных лейкозов с помощью детекции и мониторинга реаранжировок генов IgH и TCRG позволило выявить ряд закономерностей молекулярной диагностики, мониторинга минимальной резидуальной болезни, выбора терапевтической тактики и оценки ее результатов.

Выводы:

1. Определена высокая терапевтическая эффективность новой программы «ОЛЛ-2005»: полная ремиссия достигается у 85% больных, при этом общая и безрецидивная выживаемость составляют, соответственно, 70% и 42%.

2. Обнаружено, что у 68% взрослых больных ОЛЛ выявляется низкая чувствительность опухолевых клеток к преднизолону, что является фактором, влияющим на общую выживаемость: общая двухлетняя выживаемость при обнаружении менее 25% бластных клеток в костном мозге на 7 день терапии преднизолоном составила 100%;

более 25% бластных клеток - 70%.

3. Клональные реаранжировки генов тяжелых цепей иммуноглобулинов выявляются у 74% больных с В-линейным острым лимфобластным лейкозом.

Реаранжировки генов Т-клеточного рецептора гамма обнаруживаются у 86% больных с Т-линейным ОЛЛ и у 71% больных с В-линейным ОЛЛ.

4. Показано, что в дебюте острого лимфобластного лейкоза у 73% больных выявляются две и более клональные перестройки генов тяжелых цепей иммуноглобулинов и/или Т-клеточного рецептора гамма.

5. Мониторинг клональных перестроек генов тяжелых цепей иммуноглобулинов и Т-клеточного рецептора доказал, что при острых лимфобластных лейкозах наблюдается очень медленное уменьшение объема опухолевой массы:

минимальная резидуальная болезнь определяется после I фазы индукции у 94% больных, после II фазы индукции - у 70% больных, после консолидации - у 36% больных, а во время поддерживающей терапии – у 20%.

6. Показано, что обнаружение клональных перестроек генов тяжелых цепей иммуноглобулинов и/или Т-клеточного рецептора гамма на всех этапах лечения острого лимфобластного лейкоза определяет высокую (100%) вероятность развития рецидива, при этом не исключается возможность длительной персистенции маркеров минимальной резидуальной болезни при сохранении клинико-гематологической ремиссии.

Список опубликованных работ по теме диссертации:

1. В.Г.Савченко, Е.Н.Паровичникова, И.А.Демидова, Л.С.Любимова, Л.П.Менделеева, Е.И.Желнова, Е.Н.Шуравина, М.А.Вернюк, О.А.Виноградова, Ю.В.Ольшанская, И.В.Гальцева, Ю.Р.Давидян, Е.В.Домрачева, В.Л.Сурин, А.В.Мисюрин, И.А.Воробьев. «Детекция и мониторинг минимальной резидуальной болезни при острых лейкозах после трансплантации стволовых гемопоэтических клеток». Биотехнология и онкология, сборник тезисов I Российско-Американской конференции, Санкт-Петербург, Россия, 2005;

стр.62.

2. Davidyan Y.R., Surin V.L., Parovichnikova E.N., Savchenko V.G. «Detection and monitoring of IgH and TCRG gene rearrangements in the patients with acute lymphoblastic leukemia (ALL)». Annals of Hematology, Acute Leukemias XI, Munich, Germany, 2006, AbN22, p.18.

3. Ю.Р.Давидян, В.Л.Сурин, Е.Н.Паровичникова, В.Г.Савченко. «Динамическое исследование реаранжировки генов иммуноглобулинов и Т-клеточных рецепторов при острых лимфобластных лейкозах». Гематология и трансфузиология 2006;

№2, стр. 3-10.

4. Parovitchnikova E.N., Davidyan Y.R., Galtzeva I.V., Surin V.L., Vorobjev I.A., Gretzov E.A., Isaev V.G., Savchenko V.G. «Parallel Molecular and Immunological Monitoring of Minimal Residual Disease in Adult Acute Lymphoblastic Leukemia (ALL) Patients». The American Society of Hematology 48th Annual Meeting and Exposition. Blood, 2006, v.108,

Abstract

2294.



 

Похожие работы:





 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.