авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Особенности регуляции генной экспрессии в системе рестрикции-модификации ssoii

МОСКОВСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ имени М.В. Ломоносова ХИМИЧЕСКИЙ ФАКУЛЬТЕТ

На правах рукописи

Федотова Елена Александровна ОСОБЕННОСТИ РЕГУЛЯЦИИ ГЕННОЙ ЭКСПРЕССИИ В СИСТЕМЕ РЕСТРИКЦИИ-МОДИФИКАЦИИ SsoII 02.00.10 – биоорганическая химия

АВТОРЕФЕРАТ

диссертации на соискание учной степени кандидата химических наук

МОСКВА – 2009

Работа выполнена на кафедре химии природных соединений Химического факультета Московского государственного университета имени М.В. Ломоносова.

Научный консультант: доктор химических наук Кубарева Елена Александровна

Официальные оппоненты: доктор химических наук Туницкая Вера Леонидовна доктор биологических наук Вейко Наталья Николаевна

Ведущая организация: Институт биологии гена РАН

Защита состоится 22 декабря 2009 года в 16 часов на заседании Диссертационного совета Д 501.001.41 по химическим наукам при Московском государственном университете имени М.В. Ломоносова по адресу: 119991, Москва, Ленинские горы, Институт физико-химической биологии имени А.Н. Белозерского МГУ, аудитория 501.

С диссертацией можно ознакомиться в библиотеке Химического факультета МГУ имени М.В. Ломоносова.

Автореферат разослан 20 ноября 2009 г.

Учный секретарь Диссертационного совета, кандидат химических наук Смирнова И.Г.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Системы рестрикции-модификации (Р-М) широко распространены в бактериальных клетках и содержат гены, кодирующие ферменты рестрикции (эндонуклеаза, ЭР) и модификации (метилтрансфераза, МТаза). Системы Р-М могут выступать в роли дискретных форм жизни аналогично вирусам и транспозонам (Kobayashi et al., 2001). Эндонуклеаза рестрикции гидролизует вторгающуюся ДНК, не модифицированную должным образом, то есть система Р-М выполняет функцию примитивной иммунной системы, защищающей бактерию-хозяина от проникновения чужеродной ДНК. Также в некоторых случаях было показано, что системы Р-М могут вести себя как эгоистичные мобильные элементы и вызывать перестройку генома. После закрепления системы Р-М в геномной ДНК она становится жизненно важной для бактерии. При потере клеткой системы Р-М долгоживущая (по сравнению с метилтрансферазой) эндонуклеаза рестрикции неминуемо приведет к гибели клетки (Rocha et al., 2001). Нарушение функции специфического метилирования ДНК клетки-хозяина также может приводить к е гибели за счет расщепления собственной ДНК. В то же время, соотношение внутриклеточной активности МТазы и ЭР должно быть таким, чтобы ЭР могла гидролизовать чужеродную ДНК до того, как она будет специфически модифицирована МТазой. Таким образом, регуляция экспрессии генов ЭР и МТазы играет чрезвычайно важную роль при функционировании систем Р-М в клетках бактерий, что определяет актуальность всестороннего изучения этого процесса.

Исследования регуляции активности генов в системах Р-М, проведенные в последнее время, показали, что не существует универсального механизма этого процесса. Однако регуляция на уровне транскрипции, по-видимому, является определяющим механизмом координированной экспрессии генов систем Р-М. Выделяют 3 основных типа подобной регуляции систем Р-М: посредством С-белков (от английского слова «control»), посредством метилирования промоторной области системы Р-М МТазой, а также посредством взаимодействия МТаз с регуляторными последовательностями ДНК, отличными от участка метилирования. Последний тип регуляции характерен для С5-цитозиновых ДНК-метилтрансфераз.

Объектом нашего исследования является система Р-М II-го типа SsoII, обнаруженная в штамме Shigella sonnei 47. Эта система является уникальной среди других систем Р-М, для которых описана регуляция экспрессии генов посредством С5 цитозиновых ДНК-МТаз (M.Msp, M.EcoRII, M.ScrFI, M.LlaJI). Показано, что помимо авторегуляторной функции – ингибирования собственного синтеза – MТаза SsoII (М.SsoII) активирует транскрипцию гена ЭР SsoII (R.SsoII) (Karyagina et al., 1997).

Регуляция в этой системе осуществляется благодаря специфическому взаимодействию N-концевой области M.SsoII (1-71 а.о.) с промоторной областью генов системы Р-М SsoII (Shilov et al., 1998). Основное число контактов с М.SsoII обеспечивает локализованный внутри промоторной области 15-звенный инвертированный повтор (регуляторный участок) (Воробьева и др., 2000). Несмотря на активное изучение взаимодействия M.SsoII с регуляторным участком, непосредственно механизм регуляции экспрессии генов в системе Р-М М.SsoII оставался еще невыясненным.

Вместе с тем, всестороннее исследование этого процесса, возможно, позволит выявить закономерности регуляции экспрессии генов в прокариотических клетках и глубже понять его основные аспекты.

Цель и задачи исследования. Цель работы заключалась в установлении особенностей механизма регуляции в системе рестрикции-модификации SsoII.

В ходе работы необходимо было решить следующие задачи.

1. Изучить in vitro транскрипцию генов системы Р-М SsoII в присутствии и в отсутствие метилтрансферазы SsoII и SsoII-подобной МТазы Ecl18kI.

2. Оценить эффективность комплексообразования МТазы и РНК-полимеразы E. coli с фрагментами ДНК, содержащими регуляторные элементы генов системы Р-М SsoII.

3. Выяснить способность полипептида, представляющего собой N-концевую область М.SsoII (1-71 а.о.), выступать в роли фактора транскрипции, то есть связываться с промоторной областью генов системы Р-М SsoII и регулировать их экспрессию.



4. Исследовать роль отдельных аминокислотных остатков N-концевой области М.SsoII во взаимодействии с регуляторным участком и их влияние на транскрипционную активность фермента.

5. Установить, существует ли взаимосвязь между регуляторной и метилирующей функциями M.SsoII.

Научная новизна и практическая значимость работы. Показано, что М.Ecl18kI аналогично M.SsoII регулирует экспрессию генов in vitro в системе Р-М SsoII. Уровень синтеза транскрипта c промотора гена ЭР в отсутствие МТазы незначителен, однако он возрастает при добавлении в реакционную смесь МТазы (M.SsoII или M.Ecl18kI). Синтез транскрипта с промотора гена МТазы в присутствии 4-кратного относительно РНК полимеразы избытка M.SsoII или M.Ecl18kI полностью подавляется. Установлено, что ингибирование транскрипции гена M.SsoII осуществляется за счет связывания МТазы с регуляторным участком вблизи собственного промотора. Эффективность данного взаимодействия выше, чем эффективность связывания РНК-полимеразы с промотором гена МТазы. Показано, что метилтрансфераза не мешает образованию открытого комплекса РНК-полимеразы E. coli с промотором гена ЭР. Активация транскрипции гена ЭР происходит за счет снятия эффекта транскрипционной интерференции посредством блокирования МТазой собственного промотора.

Показано, что делеционная форма SsoII-подобной метилтрансферазы Ecl18kI (72-379)Ecl18kI не взаимодействует с регуляторным участком в составе 31-звенного ДНК-дуплекса и фрагментов ДНК, содержащих межгенную область системы Р-М. Такой белок не способен регулировать экспрессию генов в системе рестрикции-модификации SsoII. Следовательно, наличие области, ответственной за метилирование, необходимо для связывания M.SsoII с регуляторным участком и выполнения функции фактора транскрипции.

Установлено, что мутантные формы SsoII-подобной МТазы Ecl18kI:

M.Ecl18kI(R35A) и M.Ecl18kI(R38A) практически не взаимодействуют с регуляторным участком как в составе 31-звенного дуплекса, так и в составе ДНК, содержащей межгенную область системы Р-М SsoII. По-видимому, остатки Arg35 и Arg38 играют ключевую роль в связывании регуляторного участка. В экспериментах по транскрипции in vitro продемонстрировано, что M.Ecl18kI(R35A) и M.Ecl18kI(R38A) не способны регулировать транскрипцию. Отсутствие контактов лизина с углеводофосфатным остовом регуляторного участка ДНК было показано методом аффинной модификации белка 2 альдегидсодержащими ДНК-дуплексами. Совокупность полученных данных в целом согласуется с нашими теоретическими предположениями, основанными на анализе модели комплекса N-концевой области M.SsoII с регуляторным участком (Karyagina et al., 2003). Остатки Arg35 и Arg38 довольно «жестко закреплены» около ДНК, в то время как остальные аминокислотные остатки не столь критичны для взаимодействия с лигандом.

Нами впервые показано, что аминокислотные замены в N-концевой области SsoII подобной МТазы Ecl18kI влияют не только на ее способность регулировать транскрипцию в системе Р-М, но и на метилирующую активность фермента. В свою очередь замена Cys142 на Ala в области белка, ответственной за метилирование, приводит к увеличению его сродства к регуляторному участку в ДНК. Полученные данные свидетельствуют о существовании взаимосвязи между функционированием двух ДНК-связывающих центров SsoII-подобных МТаз.

Принимая во внимание значительную структурную гомологию всех С5 цитозиновых ДНК-метилтрансфераз, включая эукариотические, результаты, полученные для М.SsoII и М.Ecl18kI, могут быть использованы для анализа принципов организации, структуры и механизма функционирования этих ферментов, а также для конструирования новых регуляторных белков, обладающих направленным влиянием на процесс регуляции в системах Р-М.

Публикации и апробация работы. По материалам диссертации опубликовано статьи в российских и международных периодических изданиях. Результаты были представлены на конференции «Ломоносов-2006» (Москва, Россия, апрель 2006 г.), конференции «Ломоносов-2007» (Москва, Россия, апрель 2007 г.), конференции «Offspring-Meeting of the International Research Training Group Gieen/Marburg-Moscow» (Москва, Россия, февраль 2008 г.), конференции Spring-Meeting and Workshop «Protein protein interactions» (Раушхольцхаузен, Германия, март 2008 г.), IV-ом съезде Российского общества биохимиков и молекулярных биологов (Новосибирск, Россия, май 2008 г.) и конференции «Ломоносов-2009» (Москва, Россия, апрель 2009 г.).

Структура и объем диссертационной работы. Диссертация изложена на страницах машинописного текста и содержит следующие разделы: введение, обзор литературы (посвящен регуляции экспрессии генов в системах рестрикции-модификации прокариот на уровне транскрипции), обсуждение результатов, экспериментальную часть, выводы и список литературы. Материал иллюстрирован 84 рисунками, 5 схемами, таблицами. Библиографический указатель включает в себя 95 цитированных работ.

Работа выполнена при поддержке гранта РФФИ 07-04-00545 и программы РФФИ ННИО «Международные исследовательские группы с участием молодых ученых» (гранты 08-04-91973 ННИОМ_а и IRTG GRK 1384).

СОДЕРЖАНИЕ РАБОТЫ

Гены МТазы и ЭР системы Р-M SsoII расположены в природной плазмиде P (4250 н.п.) штамма Shigella sonnei 47, и направлены дивергентно;





межгенная область составляет 109 н.п. (Karyagina et al., 1997). Описано, по крайней мере, еще десять SsoII подобных систем Р-М: Ecl18kI, Kpn2kI, StyD4I, SenPI, BadAORF1283P, FpsJIPORF2150P, NlaCORFPP, PpuGBORF4748P, NlaXP, PspGI (http://tools.neb.com/), выделенных из различных бактериальных штаммов. Ферменты этих систем Р-М отличаются друг от друга 1-2 аминокислотными заменами, их генетическая организация практически идентична. В данной работе исследовано влияние M.SsoII, SsoII-подобной M.Ecl18kI и их мутантных форм на транскрипцию генов ферментов Р-М в системе SsoII in vitro.

M.Ecl18kI из штамма Enterobacter сloacea узнает в двутяжевой ДНК ту же пентануклеотидную последовательность, что и M.SsoII (5'-CCNGG-3'/3'-GGNCC-5'), и в присутствии кофактора S-аденозил-L-метионина (AdoMet) также метилирует внутренний остаток C в этой последовательности с образованием 5-метил-2' дезоксицитидина (Denjmukhametov et al., 1998). Метилтрансфераза Ecl18kI отличается от М.SsoII только одной аминокислотой: в позиции 56 М.Ecl18kI содержит Met, а M.SsoII – Ile.

Мы изучили связывание M.Ecl18kI с 31-звенным синтетическим лигандом – фрагментом промоторных областей SsoII-подобных систем Р-М, содержащим регуляторный участок, установленный для M.SsoII (выделен) (Воробьева и др., 2000).

5'-ATCAAAACAGGACAAATTGTCCTAAAACCAA-3' 3'-TAGTTTTGTCCTGTTTAACAGGATTTTGGTT-5' (дуплекс I) Показано, что Кd комплекса M.Ecl18kI с дуплексом I равна 224 ± 24 нМ и совпадает в пределах ошибки с Кd комплекса M.SsoII с этим дуплексом (248 ± 33 нМ).

Для изучения транскрипции генов в системе Р-М SsoII in vitro нами методом ПЦР был получен ДНК-фрагмент II длиной 247 н.п., содержащий межгенную область и участки начала обоих генов (представлен на рис. 1). Используя его в качестве матрицы, M.Ecl18kI, ее делеционная и мутантные формы любезно предоставлены Проценко А.С., Захаровой М.В. и Солониным А.С. (ИБФМ РАН), М.SsoII, M.SsoII(C142A) и M.NlaX - Карягиной А.С., Лавровой Н.В. (НИИЭиМ РАМН), Рязановой Е.М. и Тихоновой Т.В. (ВНИИСБ РАСХН).

Фрагменты ДНК, в том числе модифицированные, синтезированы сотрудниками НИИФХБ и химического факультета МГУ Романовой Е.А. и Зацепиным Т.С. под руководством проф. Орецкой Т.С. Часть работы выполнялась в Институте биохимии Университета им. Ю. Либиха (г. Гиссен, Германия) под руководством проф. Фридхофа П. в рамках программы РФФИ-ННИО «Международные исследовательские группы с участием молодых ученых».

мы провели эксперименты по транскрипции в отсутствие и в присутствии M.SsoII или М.Ecl18kI. Для этого РНК-полимеразу E. coli (РНКП) вначале инкубировали при 37°C с ДНК-фрагментом II в присутствии эквимолярного белку количества гепарина для предотвращения образования неспецифических комплексов, а затем добавляли в реакционную смесь четыре нуклеозид-5'-трифосфата (в том числе [ -32Р]UTP). Было показано, что и M.SsoII, и М.Ecl18kI регулируют экспрессию генов в системе Р-М SsoII (рис. 2). Уровень синтеза транскрипта c промотора гена ЭР в отсутствие МТазы невысок, однако при добавлении в реакционную смесь M.SsoII или M.Ecl18kI он возрастает.

Синтез транскрипта с промотора гена МТазы в присутствии 4-кратного избытка M.Ecl18kI или M.SsoII по отношению к РНК-полимеразе (в единицах активности) полностью подавляется. Полученные результаты дают основания говорить об общности механизмов функционирования систем Р-М SsoII и Ecl18kI.

ДНК-фрагмент II (247 н.п.) Рис. 1. ДНК-фрагмент II, содержащий промоторную область генов системы Р-М SsoII.

Направления генов M.SsoII и R.SsoII показаны тонкими черными стрелками, начала кодирующих их последовательностей подчеркнуты, инициаторные кодоны отмечены прямоугольниками. Место посадки М.SsoII выделено серым цветом. Красным шрифтом и красными стрелками отмечен регуляторный участок М.SsoII, представляющий собой инвертированный повтор. Экспериментально установленные точки инициации транскрипции генов МТазы и ЭР выделены розовым цветом, промоторные области для них – синим.

Теоретически предсказанная точка инициации транскрипции ЭР и промоторные области для нее отмечены фиолетовым цветом.

Рис. 2. Анализ РНК-транскриптов с ДНК-фрагмента II (247 н.п.), содержащего межгенную область системы Р-М SsoII и участки начала генов ЭР и МТазы SsoII. A. Радиоавтограф 5%-го ПААГ после электрофореза в денатурирующих условиях. Б. Фотография геля после окрашивания раствором Sybr Gold. 1, 4 – Продукты транскрипции в присутствии 4-кратного избытка M.Ecl18kI или M.SsoII по отношению к РНК-полимеразе, 2, 3 – продукты транскрипции в отсутствие M.Ecl18kI или M.SsoII. R – РНК-транскрипт с промотора гена ЭР, M – РНК транскрипт с промотора гена МТазы соответственно. РНК-М - РНК-маркер, длина фрагментов указана в нуклеотидных остатках (н.о.) справа.

1. Механизм регуляции транскрипции генов в системе Р-М SsoII На основе сравнительного анализа нуклеотидных последовательностей родственных систем Р-М были теоретически предсказаны точки инициации транскрипции и промоторные области генов М.SsoII и R.SsoII (Karyagina et al., 1997) (рис. 1). Используя в качестве матрицы ДНК-фрагмент II длиной 247 н.п., содержащий межгенную область и начала участков обоих генов, мы провели эксперименты по транскрипции in vitro и оценили длины транскриптов генов ssoIIM и ssoIIR с помощью РНК-маркера (рис. 2). Оказалось, что длина транскрипта с промотора гена МТазы (~ н.о.) сравнима с ожидаемой (111 н.о.), а длина транскрипта с промотора гена ЭР значительно больше (~200 н.о. вместо 122 н.о., предсказанных теоретически). По видимому, точка инициации транскрипции гена R.SsoII удалена от точки инициации транскрипции гена М.SsoII. Для проверки этой гипотезы нами были синтезированы два фрагмента ДНК, содержащие предполагаемую точку инициации транскрипции гена ЭР:

дуплекс III длиной 86 н.п. (включающий участок начала гена МТазы) и дуплекс IV длиной 110 н.п. (включающий и участок начала гена МТазы, и регуляторный участок) (рис. 3, А). Оба фрагмента ДНК в условиях образования открытого комплекса (в присутствии гепарина) связывались с РНК-полимеразой (рис. 3, Б). Следовательно, реальная точка инициации транскрипции гена ssoIIR действительно не соответствует предсказанной теоретически и расположена в области начала гена МТазы. Полученные нами результаты согласуются с опубликованными в 2009 г. данными Проценко и соавт., которые определили точки инициации транскрипции в SsoII-подобной системе Р-М Ecl18kI.

Рис. 3. A. Фрагменты ДНК длиной 86 н.п. (III) и 110 н.п. (IV). Стрелками показаны направления генов МТазы (M) и ЭР (R) SsoII. Черным прямоугольником отмечен регуляторный участок М.SsoII. Б. Анализ комплексообразования ДНК-фрагментов III и IV (концентрация 15 нМ) с РНК-полимеразой E. coli (концентрация 60 нМ) методом электрофореза в 2%-ном агарозном геле (дорожки 2 и 3 соответственно). Дорожки 1 и 4 – исходные фрагменты ДНК. Реакционные смеси содержали гепарин (300 нМ). Выходы ДНК-белковых комплексов приведены под дорожками геля.

Близкое расположение регуляторного участка и точки инициации транскрипции гена МТазы, и, более того, перекрывание последней с местом посадки М.SsoII, позволило нам предположить, что ингибрование МТазой транскрипции собственного гена обусловлено конкуренцией РНК-полимеразы и МТазы за участок связывания. Методом Скэтчарда мы определили константы диссоциации комплексов РНК-полимеразы и M.Ecl18kI с ДНК фрагментом V длиной 116 н.п., содержащим и регуляторный участок, и точку инициации транскрипции, и промоторные области гена ssoIIM (рис. 4). Кd комплекса РНК-полимеразы E. coli с дуплексом V (25±1 нМ) оказалась в 2 раза больше, чем Кd комплекса M.Ecl18kI с этим ДНК-фрагментом (12±1 нМ). Поскольку ингибирование МТазой транскрипции собственного гена происходит при избытках фермента то, по видимому, данного различия в эффективностях связывания с ДНК оказывается достаточно, чтобы конкуренция за участок узнавания смещалась в сторону МТазы.

Такое соотношение констант диссоциации комплексов белков с ДНК, вероятно, поддерживает оптимальное функционирование системы Р-М в клетке, позволяя предотвратить преждевременное ингибирование собственного синтеза МТазы и обеспечивая специфического метилирование клеточной ДНК.

Рис. 4. ДНК-фрагмент V длиной 116 н.п., содержащий межгенную область системы Р-М SsoII (направления генов указаны стрелками M и R). Точка инициации транскрипции гена ssoIIM отмечена стрелкой с подписью +1 и М, -10 и -35 промоторные области выделены черным цветом. Серым шрифтом и соединяющимися стрелками отмечен регуляторный участок M.SsoII.

Для того чтобы понять возможный механизм активации транскрипции гена ЭР, мы оценили эффективность взаимодействия РНК-полимеразы с двумя различными фрагментами ДНК, каждый из которых содержал соответственно только промотор гена МТазы (V) или только промотор гена ЭР (IV). Степень связывания РНК-полимеразы с дуплексом IV в 4 раза меньше, чем с дуплексом V (рис. 5). Таким образом, в отсутствие МТазы транскрипция идет в первую очередь с промотора гена ssoIIM, который является более сильным в данной системе.

Рис. 5. Анализ комплексообразования ДНК-фрагментов V и IV (концентрация 30 нМ) с РНК полимеразой E. сoli (концентрация 190 нМ) методом электрофореза в 2%-ном агарозном геле (дорожки 2 и 3 соответственно). Дорожки 1 и 4 – исходные фрагменты ДНК. Реакционные смеси содержали гепарин (300 нМ). Выходы ДНК-белковых комплексов приведены под дорожками геля.

Рис. 6. Механизм регуляции в системе Р-М II-го типа SsoII. А. Стадия проникновения в клетку:

активный синтез МТазы для защиты хозяйской ДНК. Б. Состояние системы, обеспечивающее эффективную защиту клетки от инфекции бактериофагом: МТаза блокирует собственный синтез и активирует синтез ЭР. Белыми овалами обозначены молекулы РНК-полимеразы, темно-серым овалом – сигма субъединица РНК-полимеразы, белым и серым прямоугольниками – промоторы генов ЭР и МТазы соответственно, тонкими стрелками – стартовые точки транскрипции генов ЭР и МТазы соответственно, черным прямоугольником – регуляторный участок, волнистыми линиями – РНК-транскрипты.

Исходя из полученных результатов, регуляцию в системе Р-М SsoII можно представить в виде следующей схемы: на стадии проникновения системы в клетку сильный промотор гена МТазы снижает активность слабого промотора гена ЭР, то есть наблюдается транскрипционная интерференция (при этом идет активный синтез МТазы для защиты хозяйской ДНК). Cо временем нарабатывается определенное количество МТазы, обеспечивающее эффективную защиту клетки от инфекции бактериофагом. При этом осуществляется негативная авторегуляция: МТаза подавляет транскрипцию своего собственного гена. Как классический репрессор, связываясь с регуляторным участком, МТаза блокирует доступ РНК-полимеразы к промотору собственного гена (стерическое препятствие). Таким образом, МТаза косвенно стимулирует транскрипцию гена ЭР, освобождая его от транскрипционной интерференции (рис. 6).

Вероятно, при активации транскрипции с промотора гена ЭР происходит «сталкивание» комплекса МТазы с ДНК. Это может быть связано с понижением сродства МТазы к ДНК, «расплетенной» в процессе элонгации. Эта гипотеза подтверждается результатами ряда экспериментов. Так, M.SsoII не взаимодействует с одноцепочечной ДНК, содержащей регуляторный участок. Кроме того, нами были сконструированы модифицированные дуплексы, являющиеся структурными аналогами ДНК-дуплекса, содержащего регуляторный участок и содержащие один или два остатка gl тимидингликоля (T ) (табл. 1).

Таблица 1. Некоторые физико-химические характеристики тимидингликольсодержащих ДНК дуплексов и их немодифицированного аналога.

Kd комплекса Т пл, oC ДНК-дуплекс *(5'-3'/3'-5') дуплекса с N (±1) M.Ecl18kI, нМ ATCAAAACAGGACAAATTGTCCTAAAACCAA I 224 TAGTTTTGTCCTGTTTAACAGGATTTTGGTT ATCAAAACAGGA-CAAATTGTCCTAAAACCAA VI 374 gl TAGTTTTGTCCT GTTTAACAGGATTTTGGTT gl ATCAAAACAGGACAAATTGT CCTAAAACCAA VII 363 TAGTTTTGTCCTGTTTAACA-GGATTTTGGTT gl ATCAAAACAGGA-CAAATTGT CCTAAAACCAA 49 VIII gl TAGTTTTGTCCT GTTTAACA-GGATTTTGGTT gl *Жирным шрифтом выделен регуляторный участок, T – остаток 5,6-дигидро-5,6 дигидрокситимидина, концентрация ДНК-дуплексов при определении Tпл составляла 2,05-2, мкМ.

Введение одной модификации в дуплекс (VI и VII) приводит к его дестабилизации на 8-12oC по сравнению с немодифицированным дуплексом (I) и понижает сродство M.Ecl18kI к ДНК-лиганду примерно в 1,5 раза. Для ДНК-дуплекса VIII, содержащего два gl остатка T (по одному в каждой цепи) и имеющего Тпл на 23°С ниже чем немодифицированный дуплекс I, при 50-240-кратных избытках M.Ecl18kI относительно ДНК комплекс не был зафиксирован. Таким образом, можно заключить, что дестабилизация двойной спирали в регуляторном участке препятствует связыванию SsoII-подобных метилтрансфераз с ДНК.

2. Свойства делеционных производных М.SsoII и М.Ecl18kI Как уже упоминалось, M.Ecl18kI и M.SsoII представляют собой уникальные бифункциональные белки: с одной стороны, каждый из них это фактор транскрипции в своей системе Р-М, а с другой – фермент, катализирующий реакцию метилирования.

Известно, что регуляция осуществляется благодаря специфическому взаимодействию N концевой области M.SsoII (аминокислотные остатки 1-71) с промоторной областью генов системы Р-М SsoII (Karyagina et al., 1997). Области M.SsoII и M.Ecl18kI с 72 по 379 а.о.

обеспечивают другую функцию этих белков – метилирование ДНК.

Взаимосвязаны ли две ДНК-связывающие активности этих МТаз, или области, ответственные за регуляцию и метилирование, могут функционировать независимо? Для ответа на этот вопрос требовалось сконструировать два делеционных мутанта M.SsoII (или M.Ecl18kI), один из которых представлял собой N-концевую область МТазы, а другой являлся областью белка, ответственной за метилирование, и изучить их свойства.

Нами были изучены свойства делеционного производного SsoII-подобной метилтрансферазы Ecl18kI (72 379)Ecl18kI, в котором удалена область белка, ответственная за метилирование ДНК. На основе размера, строения и функции N концевой области M.SsoII или М.Ecl18kI, можно сделать предположение, что она аналогична С-белкам, регулирующим экспрессию в других системах рестрикции модификации. Эти белки обладают высоким сродством к операторной последовательности ДНК (Streeter et al., 2004;

Swaya et al., 2005). Однако наши результаты свидетельствуют об отсутствии связывания белка (72 379)Ecl18kI с 31 звенным ДНК-дуплексом I, содержащим регуляторный участок (рис. 7).

Отсутствие ДНК-белкового комплекса в наших экспериментах может быть связано с недостаточной длиной ДНК-дуплекса I и, как следствие, низким сродством к нему (72 379)Ecl18kI. Возможно, делеционный мутант связывается с более протяженной ДНК, содержащей промоторную область генов системы Р-М SsoII. Логично предположить, что в этом случае он должен регулировать экспрессию генов этой системы.

Чтобы выяснить, может ли изолированный N-концевой фрагмент M.Ecl18kI Рис. Анализ равновесного 7.

выступать в роли регуляторного белка, мы связывания 5 -32Р-меченного ДНК изучили транскрипцию генов ssoIIR и ssoIIM in дуплекса I (концентрация 20 нМ) с vitro в присутствии (72-379)Ecl18kI. В (72 379)Ecl18kI (2000 нМ, дорожка 1) и M.Ecl18kI (150 нМ, дорожка 2) контрольном эксперименте использовали методом «торможения» в геле. полноразмерную M.Ecl18kI. Как видно из рис. 8, в присутствии М.Ecl18kI наблюдается увеличение количества РНК-транскрипта, синтезирующегося с промотора гена ЭР, и уменьшение количества РНК-транскрипта, синтезирующегося с промотора гена МТазы, в зависимости от концентрации МТазы в смеси. При добавлении в реакционную смесь полипептида (72-379)Ecl18kI наблюдается тот же результат, что и при полном отсутствии белка: большее количество РНК-транскрипта с промотора гена МТазы по сравнению с количеством РНК-транскрипта с промотора гена ЭР. Очевидно, что делеционная форма метилтрансферазы (72-379)Ecl18kI не способна быть транскрипционным фактором. Вероятно, это связано с очень низким сродством (72 379)Ecl18kI к промоторной области системы Р-М SsoII. Таким образом, наличие области, ответственной за метилирование, необходимо для эффективного связывания N-концевого фрагмента МТазы с регуляторным участком и поддержания регуляторной функции белка.

Рис. 8. Анализ РНК-транскриптов с ДНК-фрагмента методом II электрофореза в 5%-ном ПААГ, содержащем 7 М мочевину. 1, 8 – Продукты транскрипции в отсутствие – продукты M.Ecl18kI, 7, транскрипции в присутствии M.Ecl18kI (4,5 мкМ). 2 – 6 – Продукты транскрипции в присутствии возрастающего количества (72 379)Ecl18kI (0,15;

0,45;

1,3;

2,5 и мкМ), 9 – 13 – продукты транскрипции в присутствии возрастающего количества M.Ecl18kI (0,4;

0,7;

1;

2 и 3 мкМ). R – РНК транскрипт с промотора гена ЭР, M – РНК-транскрипт с промотора гена МТазы соответственно.

В этом и предшествующих исследованиях выделить гомогенный препарат (1 71)Ecl18kI в количествах, необходимых для молекулярно-биологических исследований, не удалось. Поэтому для детального исследования влияния N-концевой области на взаимодействие M.SsoII с участком метилирования мы предложили изучить свойства метилтрансферазы NlaX (M.NlaX), которая по существу является природным делеционным производным M.SsoII (Kubareva et al, 2002). Единственным существенным отличием двух ферментов является отсутствие в структуре M.NlaX N-концевой части длиной в 70 а.о.

Установлено, что Kd комплекса M.NlaX с 30-звенным ДНК-лигандом IX, содержащим участок метилирования, (162 ± 18 нМ) совпадает в пределах ошибки со значением Kd комплекса M.SsoII с этим субстратом (144 ± 14 нМ). Вместе с тем, M.SsoII примерно в 3 раза эффективнее метилирует дуплекс II по сравнению с M.NlaX.

5'-GATGCTGCCAACCTGGCTCTAGCTTCATAC-3' 3'-CTACGACGGTTGGACCGAGATCGAAGTATG-5' (дуплекс IX) Таким образом, продемонстрирована взаимосвязь между двумя ДНК связывающими центрами M.SsoII-подобных белков. Так, отсутствие первых 70 а.о., предшествующих первому консервативному мотиву С5-цитозиновых метилтрансфераз M.SsoII и M.Ecl18kI, приводит к снижению эффективности катализа переноса метильной группы с кофактора на ДНК. Наличие области SsoII-подобной МТазы, ответственной за метилирование, существенно для связывания белка с регуляторным участком.

Структурное и функциональное сходство N-концевых областей МТаз и С-белков позволяет предположить, что SsoII-подобные прокариотические метилтрансферазы с N концевой регуляторной областью могли образоваться при слиянии гомолога C-белка и метилтрансферазы.

3. Свойства мутантных форм М.SsoII и М.Ecl18kI, содержащих единичные аминокислотные замены 3.1. Мутантные формы M.Ecl18kI, содержащие замены в N-концевой области белка Основываясь на модели комплекса N-концевой области M.SsoII с регуляторным участком (Karyagina et al., 2003), было высказано предположение о взаимодействии остатков Lys21, Lys31, Arg35, Arg38, Arg39 и Arg42 с ДНК (Karyagina et al., 2003).

Действительно ли эти аминокислотные остатки вовлечены в связывание с 15-звенным инвертированным повтором? Определяют ли они способность SsoII-подобных МТаз регулировать экспрессию генов в система Р-М? Мы изучили свойства мутантных форм М.Ecl18kI, в которых один из перечисленных остатков заменен на Ala. Мутантные формы М.Ecl18kI с заменами R15A, K46A и K53A предполагалось использовать в качестве контролей.

Для оценки сродства мутантных форм M.Ecl18kI с единичными аминокислотными заменами к 31-звенному дуплексу I, содержащему регуляторный участок, определяли константы диссоциации белково-нуклеиновых комплексов методом Скэтчарда. Значения констант диссоциации комплексов приведены в табл. 2.

Таблица 2. Характеристика ДНК-связывающей, регуляторной и метилирующей активностей M.Ecl18kI и ее мутантных форм.

Отн. выход Kd комплекса Kd комплекса транскрипта МТазы с МТазы с Отн. начальная на единицу МТазы дуплексом I c дуплексом IX c скорость активной регуляторным метилируемым метилирования концентрации участком, нМ участком, нМ МТазы 224±24 87± wt Ecl18kI 1 56±13 103± Ecl18kI(R15A) 0,4 0, 48±9 87± Ecl18kI(K21A) 3,9 198±29 26± Ecl18kI(K31A) 1 нет 140± Ecl18kI(R35A) 4000 1, нет 96± Ecl18kI(R38A) 4000 93±14 266± Ecl18kI(R39A) 0,4 32± Ecl18kI(R42A) 2,5 256±4 0, 250±32 нет Ecl18kI(K46A) 13,5 206±7 нет Ecl18kI(K53A) 1,8 M.Ecl18kI(R35A) и M.Ecl18kI(R38A) практически не взаимодействуют с ДНК-лигандом I, то есть можно предположить, что остатки Arg35 и Arg38 играют ключевую роль в связывании регуляторного участка, либо их замена существенным образом меняет структуру белка.

Отсутствие контактов остатков Lys21 и Lys31 M.Ecl18kI с углеводофосфатным остовом регуляторного участка было показано методом аффинной модификации белка и его мутантных форм ДНК-дуплексами, содержащими 2 -O-(2-оксоэтил)уридиновые звенья. 2 -Альдегидная группировка таких ДНК способна селективно взаимодействовать с пространственно сближенными -аминогруппами остатков лизина в составе белково нуклеинового комплекса (схема 1). Места введения остатков 2 -O-(2-оксоэтил)уридина в ДНК были выбраны исходя из схемы контактов димера М.SsoII или M.Ecl18kI с регуляторным участком (табл. 3).

R1, R2 – фрагменты олигонуклеотидной цепи.

Схема 1.

В результате были сконструированы модифицированные дуплексы X-XIII, являющиеся структурными аналогами ДНК-дуплекса I и содержащие одну альдегидную группу в 2 -положении углеводного фрагмента. Модифицированный дуплекс XIV, без регуляторного участка ДНК использовали в качестве контроля (табл. 3). Аффинной модификации 2 -альдегидсодержащими ДНК были подвергнуты мутантные формы метилтрансферазы: и M.Ecl18kI(K21A), M.Ecl18kI(K31A), M.Ecl18kI(K46A) M.Ecl18kI(K53A). Если бы какой-то из рассматриваемых остатков Lys контактировал с модифицированной группировкой, то при его замене на Ala белково-нуклеиновый конъюгат бы не образовывался. Оказалось, что все мутантные формы M.Ecl18kI эффективно взаимодействовали с дуплексами X-XIII, содержащими регуляторный участок (табл. 3). Однако для M.Ecl18kI(K31A) обнаружено примерно 1,5-2-кратное падение эффективности образования комплекса, в котором белок ковалентно связан, с модифицированным дуплексом X. Аналогичный эффект наблюдался при взаимодействии M.Ecl18kI(K46A) с ДНК-дуплексом XI. Подобные результаты, однако, не являются доказательством участия каждого из этих остатков лизина в образовании конъюгата с реакционноспособными олигонуклеотидами, входящим в состав указанных дуплексов. Возможно, с 2'-О-2-оксоэтильной группой в дуплексах X-XIII сближено несколько остатков лизина, в том числе и обсуждаемые выше. Не исключено также опосредованное влияние проведенных аминокислотных замен на сближенность с модифицированным звеном другого остатка лизина, образующего ковалентную связь с ДНК-лигандом.

Регуляторную активность всех мутантных форм M.Ecl18kI проверяли, проводя транскрипцию in vitro. Установлено, что M.Ecl18kI(R35A) и M.Ecl18kI(R38A) не способны регулировать транскрипцию генов в системе Р-М M.SsoII (табл. 2). Вероятно, это связано с их низким сродством к промоторной области системы рестрикции модификации.

Таблица 3. Эффективность ковалентного связывания M.Ecl18kI и ее мутантных форм с ДНК дуплексами, содержащими альдегидную группу в 2'-положении углеводного фрагмента.

Выход ДНК-белкового конъюгата, % ДНК-дуплекс* Мутантные формы № (5 3 ) M.Ecl18kI M.Ecl18kI К21А К31А К46А К53А ATCAAAACAGGACAAATXGTCCTAAAACCAA X 32±6 22±3 16±2 24±4 25± TAGTTTTGTCCTGTTTAACAGGATTTTGGTT ATCAAAACAGGACAAATTGTCCTAAAACCAA XI 18±2 20±3 15±3 11±3 18± TAGTTTTGTCCTGТTTAACAGGAXTTTGGTT ATCAAAACAGGACAAATTGXCCTAAAACCAA XII 30±5 30±4 22±5 22±4 27± TAGTTTTGTCCTGTTTAACAGGATTTTGGTT ATCAAAACAGGACAAATTGTCCTAAAACCAA XIII 40±6 37±7 38±6 41±7 51± TAGTTTTGXCCTGTTTAACAGGATTTTGGTT CATACGAXGATCCATTCGCT XIV 3±1 2±1 3±1 2±1 2± GTATGCTACTAGGTAAGCGA *Жирным шрифтом выделен регуляторный участок, X – остаток 2 -О-(2-оксоэтил)уридина.

В присутствии мутантных форм М.Ecl18kI, способных связываться с регуляторным участком, наблюдается увеличение количества РНК-транскрипта, синтезирующегося с промотора гена эндонуклеазы рестрикции, и уменьшение количества РНК-транскрипта, синтезирующегося с промотора гена метилтрансферазы, что свидетельствует о способности данных белков регулировать транскрипцию (рис. 7). Для характеристики регуляторной активности МТаз определяли процент выхода РНК-транскриптов и строили кривые зависимости этой величины от концентрации МТаз в единицах активности. За единицу активности каждого белка принимали единицу его активной концентрации. Эффективность транскрипции с ДНК-фрагмента II оценивали по увеличению относительного выхода транскрипта с промотора гена ЭР на единицу активной концентрации МТазы. Эти величины рассчитывали как отношение значения углового коэффициента (тангенса угла наклона) начального прямолинейного участка кривой для каждой из МТаз к значению углового коэффициента для wt M.Ecl18kI (рис.

7, A;

табл. 2).

Рис. 7. Графики зависимости выхода РНК-транскрипта с гена ssoIIR (A) или с гена ssoIIМ (Б) от концентрации M.Ecl18kI ( ) и ее мутантных форм M.Ecl18kI(R15A) –, M.Ecl18kI(R21A) -, M.Ecl18kI(R31A) –, M.Ecl18kI(R39A) –, M.Ecl18kI(R42A) –, M.Ecl18kI(R46A) –, M.Ecl18kI(R53A) –.

Нами впервые показано, что аминокислотные замены в регуляторной области M.Ecl18kI влияют на ее способность регулировать транскрипцию в системе Р-М.

Различная динамика изменения выхода РНК-транскриптов в условиях одинаковой активной концентрации мутантных форм МТазы стала интересным и неожиданным результатом. Мы полагали, что мутантные формы, обладающие высоким сродством к регуляторному участку, должны эффективнее регулировать транскрипцию, а низким соответственно меньше влиять на данный процесс. Отсутствие такой корреляции, возможно, связано с тем, что величина Кd отражает термодинамическую стабильность комплекса МТазы с ДНК, а относительный выход продукта транскрипции на единицу активной концентрации МТазы косвенным образом характеризует скорость образования комплекса МТазы с ДНК, то есть является кинетической характеристикой процесса.

C целью дальнейшего изучения взаимного влияния двух ДНК-связывающих центров SsoII-подобных МТаз мы исследовали способность всех мутантных форм M.Ecl18kI взаимодействовать с участком метилирования. Значения Kd комплексов МТаз с 30-звенным дуплексом IX и относительные начальные скорости его метилирования ферментами приведены в табл. 2. Очевидно, что аминокислотные замены в области M.Ecl18kI, ответственной за регуляцию, влияют на способность белка связывать и метилировать субстрат.

3.2. Мутантная форма M.SsoII, содержащая замену в области, ответственной за метилирование Остаток Cys142 является единственным остатком цистеина в молекулах M.SsoII и М.Ecl18kI. Он входит в состав консервативного для всех С5-цитозиновых метилтрансфераз дипептида ProCys, играющего ключевую роль в катализе переноса метильной группы с кофактора реакции AdoMet на ДНК-субстрат (Cheng et al., 1993).

Ранее было показано, что замена Cys142 на Ala в молекуле M.SsoII приводит к потере белком ферментативной активности, однако мутантный белок сохраняет способность связываться с участком метилирования, хотя и менее эффективно по сравнению с исходной M.SsoII (Воробьева, 2004). Эти данные коррелируют с результатами, полученными в нашей работе и представленными в табл. 4. Мы впервые показали, что «выключение» метилирующей функции повышает сродство M.SsoII(C142A) к регуляторной последовательности примерно в 7 раз по сравнению с wt M.SsoII и wt M.Ecl18kI. При этом M.SsoII(C142A) сохраняет способность регулировать транскрипцию в системе Р-М SsoII на том же уровне, что и исходный белок (табл. 4).

Таблица 4. Характеристика свойств M.SsoII(С142А) в сравнении с M.SsoII и M.Ecl18kI.

M.SsoII(C142A) wt M.SsoII wt M.Ecl18kI Kd комплекса белка с дуплексом IX с 172 ± 10 144 ± 14 87 ± участком метилирования, нМ Относительная начальная скорость нет 1 метилирования дуплекса IX Kd комплекса белка с дуплексом I с 35 ± 3 248 ± 33 224 ± регуляторным участком, нМ Относительный выход транскрипта на 1 1 единицу активной концентрации МТазы Таким образом, очевидна взаимосвязь между функционированием двух ДНК связывающих центров SsoII-подобных белков. Аминокислотные замены в регуляторной области белка влияют на его способность метилировать субстрат. Существует и обратная зависимость – отсутствие ферментативной активности в полноразмерном белке приводит к увеличению его сродства к регуляторному участку в ДНК (замена Cys142 на Ala), хотя и не влияет на регуляторную функцию. Вместе с тем делеционный мутант (72 379)Ecl18kI, в котором отсутствует вся область белка, ответственная за метилирование, не связывается с регуляторным участком ДНК и теряет способность выступать в роли фактора транскрипции.

ВЫВОДЫ Установлено, что ферменты модификации - C5-цитозиновая ДНК 1.

метилтрансфераза SsoII и SsoII-подобная метилтрансфераза Ecl18kI - оказывают влияние на транскрипцию генов системы рестрикции-модификации SsoII in vitro.

Показано, что ингибирование транскрипции собственного гена SsoII-подобными 2.

метилтрансферазами обусловлено конкуренцией РНК-полимеразы и фермента модификации за участок связывания вблизи промотора гена метилтрансферазы.

Активация транскрипции гена эндонуклеазы рестрикции SsoII происходит за счет исчезновения транскрипционной интерференции в результате связывания фермента модификации с регуляторным участком.

Впервые продемонстрировано, что наличие области белка, ответственной за 3.

метилирование, необходимо для эффективного связывания SsoII-подобных метилтрансфераз с регуляторным участком и выполнения этими ферментами функции факторов транскрипции.

Показано, что замена остатков Arg35 или Arg38 метилтрансферазы Ecl18kI на 4.

аланин приводит к существенному ухудшению связывания белка с регуляторным участком.

Впервые обнаружена взаимосвязь между функционированием двух ДНК 5.

узнающих центров SsoII-подобных метилтрансфераз. Аминокислотные замены в регуляторной области фермента модификации Ecl18kI влияют на его способность метилировать субстрат. Существует и обратная зависимость: «выключение» каталитической функции метилтрансферазы SsoII приводит к увеличению сродства мутантной формы белка к регуляторной последовательности.

Основные результаты работы изложены в следующих публикациях:

Федотова Е.А., Проценко А.С., Захарова М.В., Лаврова Н.В., Алексеевский А.В., 1.

Орецкая Т.С., Карягина А.С., Солонин А.С., Кубарева Е.А. SsoII-подобная ДНК метилтрансфераза Eсll8kI: взаимосвязь между регуляторной и метилирующей функциями. // Биохимия (2009) 74, вып. 1, С. 109–116.

2. Yang F., Romanova E., Kubareva E., Dolinnaya N., Gajdos V., Burenina O., Fedotova E., Ellis J.S., Oretskaya T., Hianik T., Thompson M. Detection of DNA damage: effect of thymidine glycol residues on the thermodynamic, substrate and interfacial acoustic properties of oligonucleotide duplexes. // Analyst (2009) 134, N 1, С. 41–51.

Федотова Е.А., Ян Ф., Кубарева Е.А., Романова Е.А., Проценко А.С., Вирясов 3.

М.Б., Гианик Т., Орецкая Т.С. Синтез и свойства модифицированных ДНК фрагментов с включениями тимидингликоля. // Биоорганическая химия (2008) 34, N 2, С. 215–222.

Федотова Е.А., Проценко А.С. Влияние аминокислотных замен на 4.

функционирование ДНК-метилтрансферазы SsoII как регуляторного белка. // Материалы международной конференции молодых ученых по фундаментальным наукам «Ломоносов-2006». Химия. Т. 2. С. 56.

Бабаян Т.А., Федотова Е.А., Ершова А.С., Проценко А.С. Регуляция в системе 5.

рестрикции-модификации Ecl18kI // Материалы международной конференции молодых ученых по фундаментальным наукам «Ломоносов-2007». Биоиженерия и биоинформатика. С. 20-21.

6. Fedotova E., Kubareva E. Determination of dissociation constants using Scatchard method. // Offspring-Meeting of the International Research Training Group Gieen/Marburg-Moscow (DFG/RFBR-funded). 12th-15th of February 2008. Moscow.

P. 14.

7. Fedotova E., Protsenko A., Zakharova M., Solonin A., Oretskaya T., Kubareva E.

(Cytosine-5)-DNA methyltransferase Ecl18kI: interrelation between methylation and regulatory functions. // Spring-Meeting and Workshop «Protein-protein interactions».

9th-12th of March 2008. Schlo Rauischholzhausen, Germany. P. 9.

Орецкая Т.С., Ле Тхи Хиен, Фань Ян, Федотова Е.А. Модифицированные 8.

олигонуклеотиды: химия и молекулярно-биологические исследования. // IV съезд Российского общества биохимиков и молекулярных биологов, 11.05 – 15.05.2008, Новосибирск, Россия. С. 99.

Буренина О.Ю., Бабаян Т.А., Федотова Е.А. Особенности регуляции в системе 9.

рестрикции-модификации SsoII. // Материалы международной конференции молодых ученых по фундаментальным наукам «Ломоносов-2009». Секция «Химия». Подсекция «Науки о живом». С. 5.



 

Похожие работы:





 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.