авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Днк-дуплексы с включениями тимидингликоля. физико-химические свойства и взаимодействие с днк-узнающими белками

МОСКОВСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ имени М.В. Ломоносова ХИМИЧЕСКИЙ ФАКУЛЬТЕТ

На правах рукописи

Ян Фань МОДИФИЦИРОВАННЫЕ ДНК-ДУПЛЕКСЫ С ВКЛЮЧЕНИЯМИ ТИМИДИНГЛИКОЛЯ. ФИЗИКО-ХИМИЧЕСКИЕ СВОЙСТВА И ВЗАИМОДЕЙСТВИЕ С ДНК-УЗНАЮЩИМИ БЕЛКАМИ 02.00.10 – биоорганическая химия

АВТОРЕФЕРАТ

диссертации на соискание учёной степени кандидата химических наук

МОСКВА – 2010

Работа выполнена на кафедре химии природных соединений Химического факультета Московского государственного университета имени М.В. Ломоносова Научные руководители: доктор химических наук, профессор Орецкая Татьяна Семеновна доктор химических наук Кубарева Елена Александровна

Официальные оппоненты: доктор химических наук Кочетков Сергей Николаевич доктор биологических наук Вейко Наталья Николаевна

Ведущая организация: ФГУ НИИ физико-химической медицины ФМБА

Защита состоится 15 июня 2010 года в 16 часов на заседании Диссертационного совета Д 501.001.41 по химическим наукам при Московском государственном университете имени М.В. Ломоносова по адресу: 119991, Москва, Ленинские горы, Институт физико-химической биологии имени А.Н. Белозерского МГУ, аудитория 501.

С диссертацией можно ознакомиться в библиотеке Химического факультета МГУ имени М.В. Ломоносова.

Автореферат разослан 14 мая 2010 г.

Учёный секретарь Диссертационного совета, кандидат химических наук Смирнова И.Г.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. ДНК в живых клетках непрерывно подвергается воздействию внешних факторов, таких, как ультрафиолетовый свет, ионизирующее облучение, агрессивные химические соединения. Во многих случаях в результате этих процессов возникают активные формы кислорода, которые атакуют ДНК, вызывая повреждения в углеводофосфатном остове или гетероциклических основаниях. Эти повреждения могут приводить к преждевременному старению организма, а также способствовать возникновению различных заболеваний, в том числе онкологических.

Несмотря на наличие в клетке ферментов, направленных на удаление поврежденных нуклеозидов, полностью исключить влияние окислительных повреждений на функционирование клеточных белков невозможно. Одним из наиболее частых повреждений ДНК является окисление двойной связи тимидина с образованием 5,6 дигидро-5,6-дигидрокситимидина (тимидингликоля, Tgl). В недавних исследованиях методами спектроскопии ядерного магнитного разонанса (ЯМР) и рентгеноструктурного анализа (РСА) охарактеризованы свойства ДНК-дуплексов, содержащих Tgl, динамика и стабильность двойной спирали [Kung et al., 1997;

Brown et al., 2008;

Aller et al., 2007]. Показано, что эти параметры существенными образом зависят от первичной структуры ДНК. В связи с этим, актуальным является исследование структурных и биологических последствий окисления тимидина на ДНК моделях, в которых варьируется нуклеотидный контекст, окружающий модифицированный остаток. Важными задачами остаются разработка методов обнаружения остатка Tgl в составе фрагментов ДНК, изучение влияния модифицированного нуклеозида на скорость формирования дуплексов, а также его роли в узнавании при формировании белково-нуклеиновых комплексов. На сегодняшний день накоплено много свидетельств того, что окисление тимидина имеет значительные последствия для функционирования клетки. В большинстве случаев удается наблюдать лишь конец цепи событий, первопричиной которых является появление единичного повреждения в ДНК. В последнее время предпринимаются попытки проследить реакцию отдельных клеточных ферментов на то или иное повреждение нуклеиновой кислоты. Так, широко изучается эффективность и специфичность действия ферментов репарации и различных полимераз в ответ на появление Tgl в матричной цепи ДНК или в пуле нуклеозидтрифосфатов [Aller et al., 2007;

Wang, 2002;

Brown et al., 2010;

Purmal et al., 1998]. Вместе с тем, остается актуальным исследование влияния тимидингликоля на функционирование ряда важнейших белков, оперирующих на ДНК, например, таких, как ферменты рестрикции-модификации и факторы транскрипции.

Цель работы заключалась в оценке влияния тимидингликоля - окислительного повреждения ДНК, на физико-химические свойства ДНК-дуплексов и их взаимодействие с рядом ДНК-узнающих белков в зависимости от числа модифицированных звеньев в двойной спирали и природы нуклеотидных пар, фланкирующих поврежденное звено.

В ходе работы необходимо было решить следующие задачи.

1. Синтез олигодезоксирибонуклеотидов с сайт-направленными включениями Tgl.

2. Изучение влияния остатков Tgl на структуру двойной спирали и термическую устойчивость модифицированных ДНК-дуплексов.

3. Анализ взаимодействия ДНК-узнающих белков разных классов:

фосфодиэстераз, эндонуклеаз рестрикции, ДНК-метилтрансфераз, фактора транскрипции NF-B, ДНК-полимераз с олигонуклеотидными дуплексами, содержащими в заданном положении участка узнавания остатки Tgl;

исследование влияния потери ароматичности гетероциклическим основанием на функционирование указанных белков.

Научная новизна и практическая значимость работы. В качестве адекватных моделей для изучения физико-химических и биологических свойств ДНК с окислительными повреждениями тимидина предложено использовать синтетические одно- и двуспиральные фрагменты ДНК с одним или двумя включениями Tgl.



Охарактеризованы физико-химические свойства модифицированных и немодифицированных ДНК-дуплексов различного нуклеотидного состава.

Установлено, что величина дестабилизирующего эффекта, вносимого остатком Tgl, характер кривых плавления и кооперативность перехода «спираль-клубок» непосредственно связаны с различием длины и состава фрагментов, примыкающих слева и справа к остатку Tgl. Показано, степень влияния Tgl на структуру двойной спирали зависит от длины олигонуклеотидного дуплекса, его стабильности, G·C состава, природы и полярности нуклеотидных звеньев, фланкирующих тимидингликоль. Моделирование структуры дуплексов показало, что введение тимидингликоля в состав ДНК вызывает нарушение «стэкинг»-взаимодействий, изменение локализации фосфатных групп в районе модификации и структурной организации пары Tgl·A. Это, в свою очередь, приводит к увеличению площади гидрофобной поверхности и дестабилизации ДНК-дуплекса.

Впервые изучено взаимодействие синтетических фрагментов ДНК, содержащих gl T, на функционирование фосфодиэстеразы змеиного яда, эндонуклеаз рестрикции II го типа, С5-цитозиновой метилтрансферазы SsoII, субъединиц p50 и р65 фактора транскрипции NF-B, ДНК-полимераз и.

Показано, что введение поврежденного основания в олигонуклеотидную цепь ингибирует действие фосфодиэстеразы змеиного яда. Полученная информация важна в связи с возрастающим интересом к фармакологическим свойствам нуклеаз.

Продемонстрировано, что эндонуклеаза рестрикции II-го типа SsoII может быть использована в качестве индикатора, позволяющего охарактеризовать локальные структурные изменения ДНК, вызванные остатком Tgl. Разница, обнаруженная в поведении двух ферментов – Psp6I и MspR9I, узнающих одну и ту же нуклеотидную последовательность, позволяет использовать их тандем для тестирования присутствия Tgl в ДНК.

При изучении взаимодействия ДНК-метилтрансферазы SsoII c ДНК-дуплекcами, содержащими Tgl в участке метилирования и регуляторном участке, впервые обнаружено, что наличие окисленного основания приводит к нарушению связывания фермента с обоими участками и негативно влияет на метилирование ДНК.

Замена тимидина на Tgl в одной из вырожденных позиций B-участка в целом не оказывает существенного влияния на функционирование р50 субъединицы фактора транскрипции NF-B, но в 3-5 раз ухудшает связывание модифицированных дуплексов с р65 субъединицей. Обнаружена зависимость между значениями констант диссоциации ДНК-белковых комплексов и «контекстом» B-участка (его последовательностью, местоположением Тgl и микроокружением модифицированного нуклеозида).

Полученная в данной работе информация о влиянии окислительного повреждения тимидина на термодинамические свойства двойной спирали, ее структуру и взаимодействие с ДНК-узнающими белками может быть использована при моделировании протекания различных клеточных процессов в экстремальных условиях.

Возможности химического синтеза модифицированных фрагментов ДНК, содержащих модифицированный нуклеозид в заданном положении без ограничения количества включений, открывают перспективы для создания адекватных моделей НК белковых комплексов, формирующихся и функционирующих в клетке.

Публикации и апробация работы. По материалам диссертации опубликовано статьи в российском и международных периодических изданиях. Результаты были представлены на конференции «Ломоносов-2009» (Москва, Россия, апрель 2009 г.), IV ом съезде Российского общества биохимиков и молекулярных биологов (Новосибирск, Россия, май 2008 г.), XIXth International symposium on Bioelectrochemistry and Bioenergetics (Тулуза, Франция, апрель 2007 г.) Структура и объем диссертационной работы. Диссертация изложена на страницах машинописного текста и содержит следующие разделы: введение, обзор литературы, обсуждение результатов, экспериментальную часть, выводы и список цитируемой литературы. Материал иллюстрирован 58 рисунками, 4 схемами, таблицами. Библиографический указатель включает в себя 160 цитированных работ.

Работа выполнена при поддержке РФФИ (гранты 09-04-0315, 10-04-01578), РФФИ ННИО «Международные исследовательские группы с участием молодых ученых» (грант 08-04-91974 ННИОМ).

СОДЕРЖАНИЕ РАБОТЫ

1. Синтез олигодезоксирибонуклеотидов с включениями тимидингликоля Cинтезирована серия 19-31-звенных олигонуклеотидов, содержащих один или два остатка Tgl. Для введения модификации был использован коммерческий модифицированый амидофосфит (Glen Research, США) (рис. 1). Модифицированные Tgl-содержащие олигонуклеотиды получали на автоматическом ген-синтезаторе по стандартному регламенту амидофосфитного синтеза. Время присоединения модифицированного производного было увеличено до 5 мин. Гидроксильные функции при С5- и С6-атомах блокированы трет-бутилдиметилсилильными (TBDMS) защитными группами. Учитывая возможность разрушения модифицированного звена в концентрированном растворе аммиака при нагревании, в олигонуклеотидном синтезе были использованы 3'-амидофосфитные производные дезоксирибонуклеозидов с лабильными защитными группами гетероциклических оснований. Для удаления защитных групп и отщепления олигонуклеотидного материала от полимерного носителя его обрабатывали концентрированным раствором аммиака в течение 2 ч при комнатной температуре. После удаления TBDMS-групп (триэтиламин тригидрофторид, 40oС, 18 ч) олигонуклеотиды подвергали гель-фильтрации.

Рис. 1. Строение амидофосфитного производного Tgl и его цис-(5R, 6S) изомера.

Известно, что при деблокировании Tgl-содержащих олигомеров (аммиачная обработка) и далее при хранении олигонуклеотидов в водно-буферных растворах происходит эпимеризация при С6-атоме Tgl. Таким образом, в растворе присутствуют оба изомера – цис-(5R, 6S) и транс-(5R, 6R), но преобладающим является (5R, 6S) эпимер. Выделение чистого изомера не представляется возможным, поэтому в данной работе использовали смесь 5R-эпимеров. Очистку и выделение модифицированных олигонуклеотидов проводили методом электрофореза в полиакриламидном геле (ПААГ), содержащем 7 М мочевину. Структуру модифицированных олигонуклеотидов подтверждали методом масс-спектрометрии. Последовательности полученных в работе тимидингликольсодержащих фрагментов ДНК представлены в табл. 1.





2. Влияние остатка тимидингликоля на устойчивость олигонуклеотидов к действию фосфодиэстеразы змеиного яда Изучена кинетика гидролиза фосфодиэстеразой из яда гремучника ромбического (ФДЭ, Sigma, США) 20- и 31-звенных олигонуклеотидов (5' gl gl GCTGCCACCCT GGGTCTAAC-3' и 5'-ATCAAAACAGGACAAATTGT CCTAAAACC AA-3') в сравнении с немодифицированными аналогами. 32Р-меченные олигонуклеотиды инкубировали с раствором ФДЭ при 37oС в течение 1-20 мин.

Реакционные смеси анализировали методом электрофореза в 20%-ном ПААГ с 7 М мочевиной, строили кинетические кривые и определяли начальные скорости гидролиза олигонуклеотидов (рис. 2). Оказалось, что введение поврежденного основания в олигонуклеотидную цепь повышает её устойчивость к действию ФДЭ. Начальная скорость гидролиза этим ферментом модифицированных олигонуклеотидов примерно в 1,5 раза ниже, чем немодифицированных аналогов.

Рис. 2. Кинетические кривые гидролиза 20-звенных модифицированного (кривая 1) и немодифицированного (кривая 2) олигонуклеотидов ФДЭ.

3. Физико-химические свойства ДНК-дуплексов, содержащих тимидингликоль 3.1. Зависимость устойчивости дуплексов от температуры Методом УФ-спектроскопии изучена термическая устойчивость ДНК-дуплексов I-XV, сформированных из олигонуклеотидов, содержащих один или два остатка Tgl, и комплементарных им матриц (табл. 1). Определяли зависимость оптического поглощения исследуемого образца от температуры в буфере А: 10 мM Трис-HCl (рН 7,6), 10 мM MgCl2.

Введение одного остатка Tgl в 19-звенный ДНК-дуплекс приводит к его дестабилизации на 8-13oC. Введение двух остатков Tgl в одну или разные цепи еще больше дестабилизирует двойную спираль (ср. дуплексы II и III и дуплексы VIII и IX).

В случае дуплекса IX, в котором модифицированные остатки находятся в комплементарных цепях со сдвигом в 7 нуклеотидных пар друг относительно друга, наблюдается наибольший дестабилизирующий эффект (23oC). Очевидно, что понижение Тпл зависит от длины дуплекса и положения остатков Tgl относительно концов двойной спирали.

Эти же факторы влияют на кооперативность плавления ДНК-дуплексов и величину гипохромного эффекта. Как видно из табл. 1, величина гипохромного эффекта варьируется от 16 до 22%, при этом более низкие значения h характерны для ДНК дуплексов, содержащих модифицированные звенья. Введение одной или двух модификаций приводит к уширению кривых перехода «спираль-клубок», что отражает скрытую бифазность плавления таких ДНК-дуплексов.

Анализ методом ВЭЖХ в ион-парном варианте смесей после плавления показал, что деградации модифицированных олигонуклеотидов, входящих в состав Tgl содержащих дуплексов, не происходит.

Таблица. 1. Некоторые физико-химические характеристики синтетических ДНК-дуплексов.

Тпл,oC h260,% CD*, T**, ДНК-дуплекс № (±1) 10-6M* о (5'-3'/3'-5') (±1) C CTCACCTTGCTGACATTTT I 68 22 4,9 GAGTGGAACGACTGTAAAA CTCACCTglTGCTGACATTTT II 58 20 4,4 GAGTGGA-ACGACTGTAAAA CTCACCTglTGCTGACATglTTT III 55 19 3,7 GAGTGGA-ACGACTGTA-AAA GCTGCCACCCTGGGTCTAAC IV 75 17 4,4 CGACGGTGGGACCCAGATTG GCTGCCACCCTglGGGTCTAAC V 67 16 3,1 CGACGGTGGGA-CCCAGATTG TTGGTTTTAGGACAATTTGTCCTGTTTTGAT VI 72 22 2,6 AACCAAAATCCTGTTAAACAGGACAAAACTA TTGGTTTTAGGACAATTTGTglCCTGTTTTGAT VII 60 19 2,2 AACCAAAATCCTGTTAAACA-GGACAAAACTA TTGGTTTTAGGA-CAATTTGTCCTGTTTTGAT VIII 62 19 2,1 AACCAAAATCCTglGTTAAACAGGACAAAACTA TTGGTTTTAGGA-CAATTTGTglCCTGTTTTGAT IX 49 16 2,1 AACCAAAATCCTglGTTAAACA-GGACAAAACTA GCACCTCGGAAAGTCCCCTCT X 70 17 1,6 GAGCCTTTCAGGGGAGATG GCACCTCGGAAAGTglCCCCTCT XI 16 1,6 GAGCCTTTCA-GGGGAGATG 68*** GCACCTCGGAAATTCCCCTCT XII 68 22 1,4 GAGCCTTTAAGGGGAGATG GCACCTCGGAAATglTCCCCTCT XIII 55 16 1,4 GAGCCTTTA-AGGGGAGATG GCACCTCGGAATGTCCCCTCT XIV 69 19 1,3 GAGCCTTACAGGGGAGATG GCACCTCGGAATglGTCCCCTCT XV 58 17 1,4 GAGCCTTA-CAGGGGAGATG *CD – концентрация ДНК-дуплекса.

**T – кооперативность перехода «спираль-клубок».

***Верхнее и нижнее числа для соединения XI отвечают 1-й и 2-й ступеням на кривой его плавления.

Для выяснения влияния нуклеотидов, фланкирующих Tgl·А-пару, на физико химические свойства двойной спирали ДНК нами была охарактеризована термическая устойчивость трех пар модифицированных и немодифицированных дуплексов X-XV.

Все они имеют 17-звенную дуплексную часть. Показано, что наличие остатка Tgl в случае дуплексов XIII и XV несущественно сказывается на форме кривых плавления, однако вызывает заметное уменьшение кооперативности плавления и сильную дестабилизацию двойной спирали (табл. 1). Максимальное различие в температурах плавления (13оС) наблюдается для дуплексов XII и XIII, в которых пара Т·А или Tgl·A, соответственно, фланкирована парами А·Т и Т·А. Отметим, что дестабилизирующее влияние, вносимое остатком Tgl в G·C-окружении, минимально среди всех сравниваемых пар дуплексов и составляет ~ 7-8oC.

3.2. Характеристика структуры ДНК-дуплексов методом спектроскопии кругового дихроизма Влияние Tgl на структуру олигонуклеотидных дуплексов исследовали с помощью спектроскопии кругового дихроизма (КД). Изучены три семейства ДНК-дуплексов, различающихся длиной и содержанием G·C-пар: А·Т-богатые 31-звенные дуплексы VI IX, 20-звенные дуплексы IV и V, содержащие 70% G·C- пар, и ДНК-дуплексы X-XV, состоящие из 21-звенного и 19-звенного олигонуклеотидов, содержащие 53-59% G·C пар.

Спектры всех изученных ДНК-дуплексов имеют консервативный вид с положительным Коттон-эффектом при 260-280 нм, характерным для В-формы ДНК (рис. 3). Причем, кривые КД ДНК-дуплексов, принадлежащих к разным семействам, существенно различаются, демонстрируя характерные черты спектров A·T и G·C богатых ДНК (рис. 3,а и 3,б).

Наиболее интересны спектры КД третьей серии дуплексов. Когда окислительное повреждение фланкировано парами G·C и C·G (дуплекс XI), наблюдается понижение амплитуды положительной и отрицательной полосы по сравнению с величинами, характерными для немодифицированного ДНК-дуплекса Х (рис. 3,в). Аналогичный эффект наблюдался и для 31-звенных дуплексов VI-IX (рис. 3,a). Это, вероятно, связано с ослаблением «стэкинг»-взаимодействий в зоне модификации. В то же время, при замене остатка тимидина, окруженного парами А·Т и Т·А, на Tgl (дуплекс XIII) изменения в спектре КД носят более сложный характер: амплитуда положительной полосы существенно возрастает в случае модифицированного дуплекса, а точка нулевого перехода сдвигается в область более коротких длин волн на 8 нм. То есть степень влияния окислительных повреждений на спектры КД зависит также от того, насколько тимингликоль выведен из «стэкинг»-взаймодействия с соседними основаниями. Когда модифицированное основание окружено смешанными парами A·T и G·C, различия спектров КД дуплексов XIV и XV, не содержащего и содержащего остаток Tgl, не такие существенные, как в случае дуплексов XII и XIII, в которых варьируемый остаток фланкирован парами A·T, но сохраняют те же особенности:

амплитуда положительной полосы выше для модифицированного дуплекса, чем для природного (данные не приведены).

Таким образом, замена тимидина на остаток Tgl приводит к существенным нарушениям локальной структуры двойной спирали. Причем, характер изменения вида спектра КД зависит от природы нуклеотидных пар (A·T или G·C), фланкирующих модифицированный участок, и содержания G·C-пар.

б а г в Рис. 3. Спектры кругового дихроизма ДНК-дуплексов в буфере А при 23оС. Сплошная линия соответствует немодифицированному дуплексу, пунктирная - модифицированному. а - 31-Звенные А·Т-богатые ДНК-дуплексы VI-IX (модифицированное основание окружено G·C- и C·G-парами);

б 20-звенные G·C-богатые ДНК-дуплексы IV и V (модифицированное основание окружено C·G- и G·C парами);

в - ДНК-дуплексы X и XI (модифицированное основание окружено G·C- и C·G-парами);

г ДНК-дуплексы XII и XIII (модифицированное основание окружено А·Т- и Т·А-парами).

Методом молекулярной динамики была рассчитана равновесная структура модифицированного ДНК-дуплекса XI, содержащего Tgl. Пространственная структура центрального участка этого дуплекса представлена на рис. 4. Видно, что Tgl выпетливается в сторону большой бороздки, выводя из «стэкинг»-взаимодействия модифицированное основание.

Работа проводилась совместно с аспиранткой Андреевой М.А. под руководством ст. преп.

Головина А.В. (факультет биоинженерии и биоинформатики МГУ имени М.В. Ломоносова).

Рис. 4. Пространственная структура центрального участка ДНК gl дуплекса XI, содержащего T.

4. Взаимодействие тимидингликольсодержащих дуплексов с клеточными белками Остаток Tgl, включенный в ДНК-дуплекс, оказывает влияние на термодинамические свойства двойной спирали и на её структуру, и, как следствие, на узнавание ДНК белками. В работе изучено влияние окисления тимидина на функционирование ключевых клеточных белков, таких как эндонуклеазы рестрикции, метилтрансферазы, факторы транскрипции и ДНК-полимеразы.

4.1. Эндонуклеазы рестрикции II-го типа Эндонуклеазы рестрикции (R.) в присутствии ионов Mg2+ катализируют гидролиз фосфодиэфирной связи в определенном положении каждой из цепей двутяжевой ДНК.

Согласно базе данных REBASE двутяжевая последовательность нуклеотидов 5' CCWGG-3' (W = T или A) представляет собой один из наиболее распространенных участков узнавания ферментов, входящих в системы рестрикции-модификации (Р-М).

Эндонуклеазы с таким участком узнавания делятся на две группы в соответствии с местом гидролиза фосфодиэфирной связи в ДНК: 5'-CCWGG-3' или 5'-CCWGG-3' (стрелкой обозначено место гидролиза).

Было изучено влияние Tgl в центральной позиции участков узнавания R.MspR9I, R.Bme1390I, R.MvaI, R.Bst2UI, R.BstSCI, R.SsoII, R.Psp6I на функционирование этих эндонуклеаз рестрикции. В качестве субстратов использовали дуплексы IV и V, содержащие радиоактивную метку на 5'-конце Т-, Тgl- или А-цепи (цепи названы по центральным нуклеотидным звеньям участка узнавания ферментов). Пробы анализировали методом электрофореза в полиакриламидном геле, содержащем 7 М мочевину. Начальные скорости гидролиза отдельных цепей ДНК-дуплексов IV и V каждой из эндонуклеаз рестрикции приведены в табл. 2.

В том случае, когда Tgl непосредственно примыкал с 3'-конца к месту гидролиза эндонуклеазы рестрикции (R.MvaI, R.Bst2UI, R.MspR9I, R.Bme1390I), наблюдалось существенное замедление ее действия. Ингибирующий эффект Tgl проявлялся независимо от степени вырожденности центральной нуклеотидной пары участка Эндонуклеазы рестрикции MspR9I, Bst2UI, BstSCI и Psp6I – коммерческие препараты производства OOO «СибЭнзим» (Россия);

Bme1390I и MvaI – коммерческие препараты производства компании «Ферментас» (Литва). Эндонуклеаза рестрикции SsoII и метилтрансфераза SsoII предоставлены Карягиной А.С. (НИИЭМ РАМН) и Солониным А.С. (ИБФМ РАН).

Субъединицы р50 и р65 фактора транскрипции NF-B выделены Молочковым Н.В. (ИTЭБ РАН).

узнавания (табл. 2). Отметим, что в условиях исчерпывающего гидролиза немодифицированного дуплекса IV R.Bst2UI, степень расщепления немодифицированной цепи дуплекса V может достигать 70%. Однако гидролиз Tgl-цепи протекает с низкой эффективностью (не более 15%).

Таблица 2. Влияние тимидингликоля в участке узнавания на функционирование эндонуклеаз рестрикции.

Эндонуклеаза Участок узнавания Температура Отн. начальная скорость гидролиза рестрикции (5'3'/3'5') инкубации Дуплекс IV Дуплекс V t, oС gl T-цепь A-цепь T -цепь A-цепь CCN-GG MspR9I 37 100 100 1 GG-NCC Bme1390I 37 100 100 1 CCW-GG MvaI 37 100 100 4 GG-WCC Bst2UI 60 100 100 9 CCNGG BstSCI 55 100 100 70 GGNCC SsoII 37 100 100 370 CCWGG Psp6I 55 100 100 110 GGWCC - место гидролиза;

N = А, T, G, C;

W = A, T В том случае, когда место гидролиза эндонуклеазы рестрикции (R.BstSCI, R.Psp6I) находилось перед участком узнавания, примыкая к нему с 5’-конца за два нуклеотида до места модификации, скорость гидролиза Tgl-содержащего дуплекса V практически не изменялась по сравнению с дуплексом IV. Более того, введение Tgl в участок узнавания существенно ускоряет гидролиз ДНК эндонуклеазой рестрикции SsoII. Начальная скорость расщепления Tgl-содержащей цепи дуплекса V примерно в раза выше, чем Т-цепи субстрата IV, а для немодифицированной А-цепи дуплекса V – в 1,5 раза выше по сравнению с этой же цепью дуплекса IV (табл. 2).

Увеличение эффективности расщепления дуплекса наблюдалось и ранее при замене остатка T центральной пары участка узнавания R.SsoII на ненуклеозидную вставку (в том числе структурный аналог апиримидинового сайта – производное тетрагидрофурана), введение неканонической ТТ-пары или гибридной пары rU·dA (Виноградова и др., 1987;

Громова и др., 1991;

Kubareva et al., 1992). Известно, что конформационная подвижность ДНК-дуплексов, содержащих апиримидиновый участок, на 10-40% выше по сравнению с немодифицированными дуплексами и одноцепочечными ДНК (Marathias et al., 1999). Учитывая экспериментальные данные, можно полагать, что ДНК-дуплексы, обладающие повышенной локальной гибкостью в участке узнавания, предпочтительней узнаются и гидролизуются R.SsoII.

Разница, обнаруженная в поведении двух ферментов – Psp6I и MspR9I, узнающих одну и ту же нуклеотидную последовательность, позволяет использовать их тандем для тестирования присутствия Tgl в ДНК.

4.2. С5-цитозиновая ДНК-метилтрансфераза SsoII ДНК-метилтрансфераза SsoII (М.SsoII), второй компонент системы Р-М SsoII, так же как и R.SsoII узнает в двутяжевой ДНК пентануклеотидную последовательность, полностью вырожденную по центральной нуклеотидной паре 5'-CСNGG-3'/3'-GGNCC 5'. В присутствии кофактора реакции S-аденозил-L-метионина (AdoMet) M.SsoII метилирует внутренние остатки C этого участка.

М.SsoII – бифункциональный белок. N-Концевая область (1-71 аминокислотные остатки) обусловливает способность М.SsoII выступать в роли фактора транскрипции и регулировать экспрессию собственного гена, а также гена, кодирующего эндонуклеазу рестрикции SsoII. Регуляция осуществляется благодаря специфическому взаимодействию М.SsoII с промоторной областью генов системы Р-М SsoII, в которой локализован регуляторный участок, представляющий собой 15-звенный инвертированный повтор: 5'-AGGACAATTTGTCCT-3' 3'-TCCTGTTAAACAGGA-5' В данной работе изучено влияние Tgl на взаимодействие М.SsoII с обоими участками узнавания - метилируемым и регуляторным.

4.2.1. Взаимодействие c дуплексами, содержащими остаток тимидингликоля в участке метилирования Для характеристики сродства M.SsoII к участку метилирования использовали 20 звенные синтетические субстраты IV и V. Комплексообразование M.SsoII с ДНК лигандами IV и V изучали в присутствии поли(dI·dC), обеспечивающего специфическое связывание, и аналога кофактора S-aденозил-L-гомоцистеина (AdoHcy). За образованием комплексов следили методом «торможения» в неденатурирующем 7% ном ПААГ. Для комплексов M.SsoII с дуплексами IV и V были рассчитаны константы диссоциации по методу Скэтчарда (рис. 5).

ДНК-белковый комплекс ДНК а б Рис. 5. a - Анализ комплексообразования M.SsoII (концентрация 0,92 мкМ) с ДНК-дуплексом IV:

20 нМ (дорожка 1), 30 нМ (дорожка 2), 40 нМ (дорожка 3), 50 нМ (дорожка 4), 60 нМ (дорожка 5), 70 нМ (дорожки 6), 80 нМ (дорожка 7), 90 нМ (дорожка 8), 100 нМ (дорожка 9). K – Исходный ДНК-дуплекс. б - График зависимости доли ДНК-лиганда, связанного с M.SsoII, от равновесной концентрации соответствующих ДНК-белковых комплексов с дуплексом IV.

Значения констант диссоциации комплексов M.SsoII с ДНК-лигандами отличаются примерно в три раза. M.SsoII менее эффективно связывается с дуплексом V, содержащим Tgl (табл. 3).

Таблица 3. Взаимодействие ДНК-дуплексов с метилтрансферазой SsoII.

Отн. скорость ДНК- Структура Kd комплекса с метилирования дуплекс (5'3'/3'5')* M.SsoII, нМ M.SsoII** GCTGCCACCCTGGGTCTAAC IV 30 ± 4 1, CGACGGTGGGACCCAGATTG GCTGCCACCCTglGGGTCTAAC V 86 ± 7 0, CGACGGTGGGA-CCCAGATTG *Выделен участок узнавания M.SsoII **Данные соответствуют метилированию Т- или Тgl-цепи субстрата. Значения скорости метилирования для ДНК-дуплекса V приведены относительно скорости метилирования T-цепи дуплекса IV.

Эффективность метилирования M.SsoII дуплексов IV и V, содержащих 32Р-метку в T-цепи, оценивали по степени «защиты» субстрата от гидролиза R.SsoII. Сначала ДНК-дуплекс IV или V инкубировали с метилтрансферазой в присутствии кофактора S aденозил-L-метионина (AdoMet). После инактивации фермента и медленного охлаждения реакционной смеси добавляли MgCl2 и R.SsoII. R.SsoII не способна гидролизовать участок узнавания, если внутренний остаток C метилирован. В контрольном эксперименте дуплексы IV и V не модифицировали MTaзой, но инкубировали с R.SsoII. Полученные реакционные смеси анализировали методом электрофореза в ПААГ в денатурирующих условиях (рис. 6).

Рис. 6. Анализ продуктов гидролиза 1 2 3 4 5 ДНК-дуплексов IV и V (32Р-метка в Т или Тgl-цепи) R.SsoII. Дорожки 1 и 4 исходные дуплексы IV и V;

дорожки 2 и – гидролиз дуплекса IV и V после обработки M.SsoII;

дорожки 3 и 6 – гидролиз неметилированных дуплексов IV и V. Концентрации: 0,35 мкМ дуплексов, 92 нМ M.SsoII, 4,8 мкМ R.SsoII. Условия метилирования – 37оС, 15 мин. Условия гидролиза – 37оС, 1 ч.

Нативный дуплекс IV после инкубации с M.SsoII практически не расщепляется эндонуклеазой рестрикции, что свидетельствует о высокой эффективности его метилирования (90%). Инкубация дуплекса V, содержащего Tgl, с M.SsoII почти не «защищает» его от гидролиза ферментом рестрикции (рис. 6). Следовательно, окисление тимидина в последовательности 5'-CCTGG-3' препятствует её метилированию (степень метилирования меньше 20%) С5-цитозиновой МТазой SsoII, несмотря на вырожденность участка узнавания этого фермента по центральной нуклеотидной паре. По-видимому, это связано с тем, что сродство M.SsoII к модифицированной последовательности ниже, чем к нативному участку узнавания.

4.2.2. Взаимодействие c дуплексами, содержащими остаток тимидингликоля в регуляторном участке Ранее было показано, что М.SsoII осуществляет регуляторную функцию, связываясь с участком ДНК. M.SsoII блокирует доступ РНК-полимеразы к промотору собственного гена и практически полностью ингибирует его транскрипцию. При этом происходит активация транскрипции гена R.SsoII с более слабым промотором.

Предположительно первые остатки Т из двух симметрично расположенных блоков 5' TGT-3' в инвертированном повторе промоторной области генов системы Р-М SsoII важны для функционирования М.SsoII как фактора транскрипции (Karyagina et al., 1997;

Karyagina et al., 2003). Для проверки этой гипотезы были сконструированы модифицированные дуплексы VII-IX - структурные аналоги ДНК-дуплекса VI c gl регуляторным участком. Они содержат один или два остатка T в заданной позиции олигонуклеотидной цепи (табл. 4).

Таблица 4. Комплексообразование тимидингликольсодержащих ДНК-дуплексов и их немодифицированного аналога с метилтрансферазой SsoII.

ДНК-дуплекс* Kd комплекса дуплекса с № (5'3'/3'5') M.SsoII, нМ TTGGTTTTAGGACAATTTGTCCTGTTTTGAT VI 197± AACCAAAATCCTGTTAAACAGGACAAAACTA gl TTGGTTTTAGGACAATTTGT CCTGTTTTGAT VII 374± AACCAAAATCCTGTTAAACA-GGACAAAACTA TTGGTTTTAGGA-CAATTTGTCCTGTTTTGAT VIII 363± gl AACCAAAATCCT GTTAAACAGGACAAAACTA gl TTGGTTTTAGGA-CAATTTGT CCTGTTTTGAT IX gl AACCAAAATCCT GTTAAACA-GGACAAAACTA *Выделен регуляторный участок М.SsoII.

Комплексообразование M.SsoII c ДНК-лигандами VII-IX изучали при 37oC в присутствии poly(dI·dC). Дуплекс VI использовали в качестве контроля. За образованием комплексов следили методом «торможения» в ПААГ в неденатурирующих условиях. Значения Kd комплексов M.SsoII с дуплексами, рассчитанные методом Скэдчарда, приведены в табл. 4. Сродство M.SsoII к ДНК лигандам, содержащим одну модификацию в одной из цепей регуляторного участка (дуплексы VII и VIII), примерно в 2 раза ниже, чем к немодифицированному дуплексу VI. Для ДНК-дуплекса IX, содержащего две модификации (по одной в каждой цепи), при 50-240-кратных избытках белка относительно ДНК комплекс M.SsoII не был зафиксирован. Очевидно, что окисление рассматриваемых остатков Tgl в регуляторном участке препятствует связыванию M.SsoII с ДНК и может привести к нарушению баланса между содержанием ЭР и МТазы в клетке и при определенных условиях к ее гибели.

4.3. Ядерный фактор транскрипции NF-B Фактор транскрипции NF-B – основной индуктор воспалительных реакций и негативный регулятор клеточной гибели. Он способствует прогрессированию онкологических заболеваний, различных патологий и воспалительных процессов.

Изучение влияния различных повреждений в ДНК на связывание этого фактора с нуклеиновой кислотой чрезвычайно важно для понимания последствий, связанных с изменением NF-B-индуцируемой экспрессии соответствующих генов.

Объектами исследования в данной работе являлись отдельные субъединицы р50 и р65 фактора транскрипции NF-B человека. Каждая из субъединиц содержала на N конце дополнительный белок - глутатион-S-трансферазу (GST). Наличие GST позволяет выделять практически гомогенные белки р50-GST и p65-GST из культуры клеток E. coli в одну стадию методом аффинной хроматографии. Известно, что GST не влияет существенно на способность субъединиц р50 и p65 связываться с ДНК (Tanaka et al, 1994).

Для выяснения влияния Tgl на ДНК-связывающую активность субъединиц р50 и р65 были синтезированы ДНК-дуплексы X-XV (табл. 1), содержащие участок узнавания фактора транскрипции NF-B. Остаток Tgl вводили в одну из «вырожденных» позиций В-участка, которые заведомо не определяют специфичность белково-нуклеинового взаимодействия, а влияют только на сродство к фактору транскрипции: 5'-GGRRNNYCCC-3'/3'-CCYYNNRGGG-5' (R = A, G;

Y = T, C;

N = A, G, T, C). Методом «торможения в геле» показано, что модифицированные и немодифицированные дуплексы X-XV формируют комплексы с белком. Как в случае р50-GST, так и в случае р65-GST, наблюдали преимущественно образование двух комплексов К1 и К2, различающихся подвижностью в ПААГ в неденатурирующих условиях (рис. 7).

Для доказательства специфичной природы комплексов К1 и К2 в качестве контроля был использован 17-звенный ДНК-дуплекс XVI, не содержащий B-участок:

5'-TCAGCACCCAGGGTGCC-3' (дуплекс XVI) 3'-AGTCGTGGGTCCCACGG-5' Показано, что в одних и тех же условиях белки р50-GST и р65-GST взаимодействуют с дуплексом X, содержащим участок узнавания фактора, и практически не формируют комплексов с дуплексом XVI (выход комплексов менее 1%) (рис. 7).

Рис. 7. Анализ комплексообразования р50-GST с ДНК-дуплексом X, содержащим участок узнавания фактора транскрипции NF-В (а), и с ДНК-дуплексом XVI без кB-участка (б) в отсутствие поли(dI·dC).

Радиоавтограф 7%-го ПААГ после электрофореза в неденатурирующих условиях. Концентрация р50-GST в реакционной смеси составляла 1, мкМ (в расчете на мономер), концентрация ДНК-дуплексов – 40, 80, 120, 160, 200 нМ (дорожки 2-6 и 8 12, соответственно). Дорожки 1 и 7 – исходные ДНК-дуплексы. Условия o инкубации: 30 мин, 25 С.

Исследовано взаимодействие 32Р-меченного дуплекса X с р50-GST в присутствии возрастающих концентраций немодифицированных ДНК-дуплексов XII и XVI. Как видно из рис. 8, взаимодействие дуплекса X с белком ингибируется избытком дуплекса XII c B-участком. Очевидно, происходит вытеснение дуплекса X из центра связывания p50-GST, что снижает эффективность образования каждого из двух ДНК-белковых комплексов К1 и К2. В присутствии дуплекса XVI без B-участка наблюдается незначительное снижение эффективности связывания, которое может быть обусловлено небольшим сродством p50-GST к ДНК случайной последовательности. Аналогичные результаты были получены для субъединицы р65 фактора транскрипции NF-B.

Рис. 8. Зависимость выхода ДНК белковых комплексов К1 (сплошные линии) и К2 (пунктирные линии) с участием р50-GST от отношения концентраций дуплексов XII (кривые 1, 2) или XVI (кривые 3, 4) и дуплекса X. Концентрация дуплекса X - 50 нМ, концентрация р50-GST в расчете на мономер – 3,8 мкМ.

Для определения стехиометрии комплексов субъединиц р50 и р65 с дуплексом XII использовали метод «торможения» в геле в неденатурирующих условиях.

Анализировали подвижность нативных белков – маркеров молекулярной массы в гелях с различным содержанием акриламида. По полученным данным строили калибровочный график в логарифмических координатах, по которому оценивали молекулярную массу ДНК-белковых комплексов К1 и К2 (рис. 9). Установлено, что комплекс с большей подвижностью в геле (К2) представляет собой димер белка :

дуплекс = 1 : 1, а комплекс с меньшей подвижностью (K1) - тетрамер белка, взаимодействующий с двумя ДНК-лигандами (табл. 5).

Рис 9. Определение молекулярной массы ДНК-белковых комплексов по калибровочному графику. – Белки-маркеры, – комплексы с р50-GST;

– комплексы с р65-GST;

b1 – наклон линейной аппроксимации зависимости относительной подвижности комплексов от концентрации геля, Mw – молекулярная масса.

Таблица 5. Стехиометрия комплексов белков р50-GST и р65-GST с ДНК-дуплексом XII.

Mw Mw Mw Стехиометрия Комплекс мономерa дуплекса, комплекса комплекса, белка, кДa кДа (эксперим.), кДa Mw расчет.

р50-GST с тетрамер·2 дуплекса, 70,1 6,3 дуплексом XII, K1 р50-GST с димер·дуплекс, 70,1 6,3 дуплексом XII, K2 152, р65-GST с тетрамер·2 дуплекса, 61,8 6,3 дуплексом XII, K1 271, p65-GST с димер·дуплекс, 61,8 6,3 136, дуплексом XII, K2 135, Определены константы диссоциации белково-нуклеиновых комплексов, образуемых дуплексами X-XV с каждой из субъединиц фактора транскрипции NF-B (табл. 6). Kd комплексов р50-GST с немодифицированными дуплексами X, XII и XIV имеют сопоставимые значения. Следовательно, замена одного пуринового нуклеозида на пиримидиновый (тимидин) в «вырожденной» позиции B-участка не влияет на сродство р50 субъединицы к ДНК. Для модифицированных дуплексов XI, XIII и XV Kd комплекса с р50-GST зависит от положения Tgl в B-участке. Замена Т на Tgl в 7-ом (дуплекс XI) или в 5-ом положениях (дуплекс XV) практически не влияет на сродство фактора к ДНК-лиганду. Введение модификации в 6-ое положение B-участка приводит к двукратному ухудшению связывания белка с дуплексом XIII по сравнению с немодифицированным дуплексом XII. Отметим, что в этом случае модифицированный нуклеозид находится в окружении А·Т-пар, что приводит к более выраженным локальным нарушениям в структуре ДНК.

Таблица 6. Значения констант диссоциации комплексов субъединиц р50 и р65 фактора транскрипции NF-B с тимидингликольсодержащими ДНК-дуплексами и их немодифицированными аналогами.

Kd, нМ № ДНК-дуплекс p50-ДНК p65-ДНК 5’-GCACCTCGGAAAGTCCCCTCT-3’ X 140±29 243± 3’-GAGCCTTTCAGGGGAGATG-5’ 5’–GCACCTCGGAAAGTglCCCCTCT-3’ XI 100±20 1036± 3’–GAGCCTTTCA-GGGGAGATG-5’ 5’–GCACCTCGGAAATTCCCCTCT-3’ XII 98±14 54± 3’-GAGCCTTTAAGGGGAGATG-5’ 5’–GCACCTCGGAAATglTCCCCTCT-3’ XIII 262±33 169± 3’–GAGCCTTTA-AGGGGAGATG-5’ 5’–GCACCTCGGAATGTCCCCTCT-3’ XIV 107±15 104± 3’-GAGCCTTACAGGGGAGATG-5’ 5’–GCACCTCGGAATglGTCCCCTCT-3’ XV 79±12 437± 3’–GAGCCTTA-CAGGGGAGATG-5’ Совсем другая ситуация наблюдается при взаимодействии с дуплексами X-XV субъединицы р65 фактора транскрипции NF-B. Прежде всего, в отличие от р50-GST, р65-GST проявляет различное сродство к немодифицированным дуплексам. Наименее эффективно р65-GST связывается с дуплексом X, содержащим Ig-B-участок, наиболее эффективно – с дуплексом XII, B-участок которого сходен с B-участком Р последовательности из промотора гена интерлейкина-4 человека (B-33). Введение Тgl в любое из трех «вырожденных» положений участка узнавания фактора транскрипции NF-B в 3-5 раз ухудшает связывание белка р65 с ДНК (табл. 6). Причем чем хуже белок связывается с немодифицированным субстратом, тем менее устойчив его комплекс с ДНК-дуплексом, несущим окислительное повреждение.

4.4 ДНК-полимеразы и Система синтеза ДНК с поврежденной матрицы (translesion synthesis, TLS) - одна из основных систем, используемых клеткой при репликации поврежденной геномной ДНК. Исследование особенностей репликации с участием Tgl-содержащих фрагментов ДНК было проведено в лаборатории чл.-корр. РАН, проф. О.И. Лаврик (ИХБФМ СО РАН). Для моделирования синтеза ДНК с поврежденной матрицы в данной работе были сконструированы ДНК-дуплексы, в матричной цепи которых находился Tgl (табл. 7).

Изучали TLS-активность ДНК-полимераз и (pol и pol ) на ДНК-дуплексах XVII и XVIII с протяженными одноцепочечными участками матрицы, имитирующих интермедиаты синтеза лидирующей цепи ДНК, и на ДНК-дуплексах XIX-XXI с моно-, ди- или пентануклеотидными «брешами» c 3'-ОН и 5'-фосфатной группами, имитирующих интермедиаты синтеза отстающей цепи ДНК. Показано, что dATP и dGTP являются предпочтительными субстратами для pol при синтезе на матрице, содержащей Tgl, в то время как pol не обладает определенной специфичностью при прохождении этого типа повреждений. Кроме того, pol способна вести синтез ДНК непосредственно после встраивания корректного dAMP напротив тимидингликоля в ДНК-субстраты, содержащие протяженные 5'-одноцепочечные участки матрицы или пентануклеотидные «бреши».

Таблица. 7. ДНК-дуплексы с тимидингликолем – аналоги субстратов полимераз и.

№ ДНК-дуплекс 5'-GACTACATTTCATCTGGCTTGGGCTTCATCGTTGTCTglCAGACCTGGTGGATACCG XVII 3'-GTCTGGACCACCTATGGC 5'-GGCTTCATCGTTGTCTglCAGACCTGGTGGATACCG XVIII 3'-GTCTGGACCACCTATGGC 5'-GGCTTCATCGTTGTCTglCAGACCTGGTGGATACCG XIX 3'-CCGAAGTAGCAp GTCTGGACCACCTATGGC 5'-GGCTTCATCGTTGTCTglCAGACCTGGTGGATACCG XX 3'-CCGAAGTAGCAACAp GTCTGGACCACCTATGGC 5'-GGCTTCATCGTTGTCTglCAGACCTGGTGGATACCG XXI 3'-CCGAAGTAGCAACAGp GTCTGGACCACCTATGGC Исследовано влияние репликативных факторов RPA (репликативный белок А) и PCNA (фактор процессивности репликативных ДНК-полимераз) человека на синтез ДНК на матрице с окислительным повреждением и в ДНК-дуплексах, содержащих «бреши». Впервые показано, что PCNA оказывает стимулирующее действие на TLS активность pol, в то время как RPA не проявляет специфического влияния на функционирование этого фермента. Синтез ДНК, катализируемый pol, как на поврежденной, так и на интактной матрице не зависит от присутствия обоих факторов.

Полученные результаты подтвердили предположение об общем негативном эффекте окислительных повреждений в ДНК на клеточные процессы, связанные с возможностью появления мутаций в ДНК в процессе матричного синтеза.

ВЫВОДЫ 1. С помощью ДНК-дуплексов, содержащих остатки тимидингликоля, показано влияние окислительного повреждения на термодинамические свойства двойной спирали, ее структуру и взаимодействие с ДНК-узнающими белками.

2. Осуществлен дизайн и синтез модифицированных фрагментов ДНК с одним или двумя остатками тимидингликоля в различных положениях олигонуклеотидной цепи.

3. Методами УФ- и спектроскопии кругового дихроизма показано, что окисление тимидина приводит к существенной дестабилизации двойной спирали и локальным нарушениям ее структуры. Степень влияния тимидингликоля на структуру и стабильность ДНК-дуплекса зависит от природы нуклеотидных пар, фланкирующих модифицированный участок.

4. Впервые показано, что эндонуклеазы рестрикции II-го типа при взаимодействии с тимидингликольсодержащими ДНК-дуплексами могут служить инструментами для обнаружения окислительного повреждения в ДНК.

5. Впервые обнаружено, что наличие тимидингликоля в участке метилирования или регуляторном участке метилтрансферазы SsoII приводит к нарушению связывания фермента с ДНК-лигандом и негативно влияет на осуществление его основной функции - метилирования ДНК.

6. Установлено, что эффективность связывания субъединиц р50 и р65 фактора транскрипции NF-B с модифицированными дуплексами зависит от положения тимидингликоля и его нуклеотидного окружения в B-участке.

Основные результаты работы изложены в следующих публикациях:

1. Yang F., Romanova E., Kubareva E., Dolinnaya N., Gajdo V., Burenina O., Fedotova E., Hianik T., Thompson M., Oretskaya T. Detection of DNA damage: effect of thymidine glycol residues on the thermodynamic and interfacial acoustic properties of oligonucleotide duplexes. // Analyst (2009) 134. Р. 41-51.

2. Федотова Е.А., Ян Ф., Кубарева Е.А., Романова Е.А., Проценко А.С., Вирясов М.Б., Гианик Т., Орецкая Т.С. Синтез и свойства модифицированных ДНК фрагментов с включениями тимидингликоля. // Биоорганическая химия (2008) 34.

№ 2. С. 236-244.

3. Belousova E.A., Maga G., Yang F., Kubareva E.A., Romanova E.A., Lebedeva N.A., Oretskaya T.S., Lavrik O.I. DNA polymerases beta and lambda bypass thymine glycol in gapped DNA structures. // Biochemistry (2010) DOI: 10.1021/bi901792c;

27 April 2010.

4. Андреева М.А., Ян Ф. Анализ структуры и биологических свойств ДНК дуплексов, содержащих остаток тимидингликоля. // Материалы XVI Международной научной конференции студентов, аспирантов и молодых ученых «ЛОМОНОСОВ-2009». Секция Биоинженерия и биоинформация. С. 2.

5. Орецкая Т.С., Ле Тхи Хиен, Ян Ф., Федотова Е.А., Хомякова Е.А.

Модифицированные олигонуклеотиды: химия и молекулярно-биологические исследования. // Сборник материалов IV съезда Российского общества биохимиков и молекулярных биологов, 11-15 мая 2008 г., Новосибирск, С. 99.

6. Romanova E., Fedotova E., Yang F., Kubareva E., Gajos V., Barosik M., Hianik T., Oretskaya T. Chemical synthesis and properties of DNA fragments containing thymidine glycol residues. //

Abstract

book of XIXth International symposium on Bioelectrochemistry and Bioenergetics, Toulouse, France, 1-4 April, 2007, Р. 64.



 

Похожие работы:





 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.