авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Взаимодействие -актинина 4 с ядерными белковыми комплексами, регулирующими экспрессию генов

На правах рукописи

ХОТИН Михаил Георгиевич ВЗАИМОДЕЙСТВИЕ -АКТИНИНА 4 С ЯДЕРНЫМИ БЕЛКОВЫМИ КОМПЛЕКСАМИ, РЕГУЛИРУЮЩИМИ ЭКСПРЕССИЮ ГЕНОВ 03.03.04 – клеточная биология, цитология, гистология

Автореферат диссертации на соискание ученой степени кандидата биологических наук

Санкт-Петербург 2010

Работа выполнена в Учреждении Российской академии наук Институт цитологии РАН

Научный консультант: доктор биологических наук, профессор Пинаев Георгий Петрович Институт цитологии РАН

Официальные оппоненты: доктор биологических наук, профессор Воробьев Владимир Иосифович Институт цитологии РАН кандидат биологических наук Голубкова Елена Валерьевна Санкт-Петербургский государственный университет, Биолого-почвенный факультет

Ведущая организация: Московский Государственный Университет им. М.В. Ломоносова, НИИ физико-химической биологии им. А.Н. Белозерского

Защита диссертации состоится «18» июня 2010 года в 14 часов на заседании Диссертационного совета Д 002.230.01 при Институте цитологии РАН по адресу:

194064 Санкт-Петербург, Тихорецкий пр., д.4.

Адрес электронной почты Института: cellbio@mail.cytspb.rssi.ru Сайт: http://www.cytspb.rssi.ru Факс: 8(812) 297-35-

С диссертацией можно ознакомиться в библиотеке Института цитологии РАН.

Автореферат разослан «18» мая 2010 г.

Ученый секретарь Диссертационного совета, кандидат биологических наук Е.В. Каминская 1.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

1.1 Актуальность проблемы Изучение роли цитоскелета в регуляции экспрессии генов с каждым годом приобретает все большую актуальность по мере того, как открываются новые факты о его регуляторных функциях.

Цитоскелет состоит из актиновых филаментов, микротрубочек и промежуточных филаментов. Он образует мобильную сеть в цитоплазме клетки, организует внутриклеточное пространство, определяя форму клетки, участвует в клеточной адгезии и клеточной миграции.

Его перестройки являются первичной реакцией клеток на различные внеклеточные сигналы, такие, как изменение состава внеклеточного матрикса или воздействие ростовых факторов, и могут приводить к изменению экспрессии генов (Are et al., 2000;

Fazal et al., 2007;

Lelievre, 2009). Известно, что некоторые сигнальные молекулы, включая и транскрипционные факторы, взаимодействуют с белками актинового цитоскелета и перераспределяются в клетке при индуцированных перестройках цитоскелета (Бабаков и др., 2004;

Kustermans et al., 2008).

Гипотезы об участии цитоскелета в регуляции экспрессии генов нашли косвенное подтверждение, когда актин и ряд актин-связывающих белков, таких, как винкулин, паксилин, гельзолин, -актинин 4 и др., были обнаружены в ядре (Gettemans et al., 2005). Поскольку в ядре реализуется генетическая информация, можно предположить, что функцией белков актинового цитоскелета, перераспределяющихся в ядро, является участие в регуляции экспрессии генов и, возможно, координация ядерно-цитоплазматических процессов. Так, существует ряд работ, в которых показано участие ядерного актина в регуляции активности всех трех РНК-полимераз (Hofman et al., 2004;

Hu et al., 2004;

Philimonenko et al., 2004). Известно о его включении в белковые комплексы, регулирующие сплайсинг мРНК (Percipalle et al., 2002), и о его участии в ремоделировании хроматина (Farrants, 2008). В отличие от актина, ядерные функции актин связывающих белков, в большинстве своем, не известны.

Исследование механизмов участия актин-связывающих белков в ядерных процессах необходимо для понимания их роли в клетке и открывает возможность получения дополнительной информации о путях передачи сигнала с поверхности клетки в ядро и реализации сигналов в виде изменения уровня экспрессии определенных генов.

Одним из актин-связывающих белков, имеющих ядерную локализацию, является актинин 4. Он принадлежит к спектриновому суперсемейству и, наряду с -актинином 1, относится к группе немышечных актининов (Honda et al., 1998). Основными функциями -актинина 4 в цитоплазме считаются сшивка нитей F-актина и формирование актиновых фибрилл, их стабилизация, а также образование фокальных контактов. Перераспределение актинина 4 в ядро наблюдали при ингибировании PIP3-киназы, при деполимеризации актина и при распластывании клеток на белках внеклеточного матрикса (Honda et al., 1998;

Бабаков и др., 2004).

Существует ряд литературных данных, свидетельствующих о том, что -актинин 4 может взаимодействовать с белками, непосредственно участвующими в экспрессии генов. -Актинин входит в состав белкового комплекса, образованного транскрипционным фактором NF-Y при активации процесса транскрипции (Poch et al., 2004), и может совместно со сплайсинговым фактором BAT1 связываться с промотором гена Cyt c (Goffart et al., 2006). Ранее в Лаборатории биологии клетки в культуре ИНЦ РАН было показано, что в цитоплазме -актинин солокализован с р65 субъединицей транскрипционного фактора NF-B, а при воздействии на клетки TNF- и цитохалазина происходит совместная транслокация р65 и -актинина 4 в ядро (Бабаков и др., 2004;

Babakov et al., 2008). Кроме того, эти два белка содержатся в одном ядерном белковом комплексе во фракции транскрипционных факторов (Bolshakova et al., 2007).

Таким образом, предварительные данные позволили предположить участие -актинина 4 в регуляции активности NF-B.



Транскрипционный фактор NF-B является регулятором активности большого числа генов, вовлеченных в различные клеточные процессы, такие как пролиферация, апоптоз, клеточный цикл и др. Исследование роли -актинина 4 в регуляции активности NF-B имеет особое значение в изучении неканонических путей активации этого транскрипционного фактора и участия -актинина 4 в регуляции пролиферации, апоптоза и трансформации клетки.

Литературные данные о ядерной локализации -актинина 4 и результаты исследований, взаимодействия -актинина 4 с транскрипционным фактором NF-B, проводимых в Лаборатории биологии клетки в культуре ИНЦ РАН, привели к необходимости изучения функций этого актин-связывающего белка в ядре и его роли в регуляции активности NF-B.

1.2 Цели и задачи работы Цель данной работы заключалась в выявлении ядерных процессов, в которых принимает участие -актинин 4.

Достижение поставленной цели предполагает решение следующих задач.

1. Исследовать взаимодействие -актинина 4 с ядерными белковыми комплексами р субъединицы NF-B при распластывании клеток на различных белках внеклеточного матрикса.

2. Провести анализ возможности участия -актинина 4 в регуляции активности транскрипционного фактора NF-B в отношении ряда p65-зависимых генов.

3. Определить состав ядерных белковых комплексов, в которые входит -актинин 4.

4. Сравнить включение изоформ -актинина 4 в ядерные белковые комплексы, выполняющие различные функции.

1.3 Основные положения, выносимые на защиту 1. Содержание -актинина 4 в ядерных белковых комплексах р65 субъединицы транскрипционного фактора NF-B зависит от типа белка внеклеточного матрикса, на котором распластаны клетки, и влияет на активность этого транскрипционного фактора в отношении ряда генов.

2. В ядрах клеток А431 -актинин 4 ассоциирован приблизительно с пятьюдесятью различными белками. Среди них основными являются белки, участвующие в созревании мРНК, и традиционные цитоскелетные белки.

3. В клетках А431 экспрессируется как полноразмерная, так и ранее не описанная укороченная изоформы -актинина 4. Обе изоформы имеют как цитоплазматическую, так и ядерную локализации.

4. Изоформы -актинина 4 входят в состав различных ядерных белковых комплексов, которые выполняют разные функции.

5. Гиперэкспрессия -актинина 4 не влияет на ядерную транслокацию и активацию транскрипционного фактора NF-B.

1.4 Научная новизна полученных результатов В данной работе впервые показано включение -актинина 4 в ядерные белковые комплексы, регулирующие экспрессию генов на уровнях активации транскрипционных факторов и созревания мРНК. Анализ результатов исследований позволил выдвинуть гипотезу об участии -актинина 4 в регуляции процессинга, сплайсинга и транспорта мРНК. Показано, что -актинин 4 может регулировать активность транскрипционного фактора NF-B в отношении ряда генов, но не влияет на его перераспределение в ядро и активацию. Впервые описана новая изоформа -актинина 4, образованная путем альтернативного сплайсинга.

Обнаружено, что изоформы -актинина 4 входят в различные ядерные белковые комплексы и, следовательно, могут выполнять разные функции.

1.5 Теоретическое и практическое значение работы Полученные результаты имеют фундаментальное значение для понимания роли белков цитоскелета в ядерных процессах и регуляции экспрессии генов. Определение ядерных функций -актинина 4 способствует пониманию механизмов его участия в процессах клеточной трансформации и развития заболеваний, связанных с мутациями гена -актинина 4. Описание его роли в регуляции активности NF-B актуально для разработки терапевтических методов коррекции патологических состояний, связанных с активностью определенных транскрипционных факторов. Полученные данные могут быть использованы при чтении лекций в Санкт-Петербургском Государственном Политехническом Университете, Санкт Петербургском Государственном Университете и на биологических факультетах других ВУЗов.

1.6 Апробация работы По теме диссертации опубликовано 9 печатных работ, из которых 2 статьи в рецензируемых журналах и 7 тезисов.

Материалы диссертации были представлены на Всероссийском симпозиуме «Биология клетки в культуре» (Санкт-Петербург, 2007), Международной конференции American Society for Cell Biology (Вашингтон, 2007), на IV съезде Российского общества биохимиков и молекулярных биологов (Новосибирск, 2008), XIII Санкт-Петербургской ассамблее молодых ученых и специалистов (Санкт-Петербург, 2008), I и II Конференциях молодых ученых Института цитологии РАН (Санкт-Петербург, 2008, 2010), V съезде Вавиловского общества генетиков и селекционеров (Москва, 2009), Школе-семинаре по проблемам организации внутриклеточного транспорта, цитоскелета и путей передачи сигнала (Санкт-Петербург, 2009).

1.7 Объем и структура диссертации Диссертация состоит из введения, обзора литературы, описания материалов и методов исследований, результатов и их обсуждения, выводов и списка цитируемой литературы, включающего _ источников. Диссертация изложена на _ страницах машинописного текста.

Иллюстративный материал содержит схем, рисунков и таблиц.

Работа выполнена при финансовой поддержке программы президиума РАН «Молекулярная и клеточная биология», РФФИ (07-04-01190) и фонда Visby Шведского института.

2. МАТЕРИАЛЫ И МЕТОДЫ 2.1 Клеточные культуры Клетки эпидермоидной карциномы человека линии А431 и эмбриональные клетки почки человека линии НЕК293 были получены из Российской коллекции клеточных культур Института цитологии РАН (Санкт-Петербург). Клетки культивировали в среде DMEM (Биолот) с добавлением 10 % эмбриональной бычьей сыворотки (Gibco) и 0.1% гентамицина в атмосфере 5 % СО2 при температуре 37 °C.

2.2 Распластывание клеток на белках внеклеточного матрикса Растворы коллагенов I или IV (Fluka) в 0.1 %-ной уксусной кислоте, ламинина 2/4 или фибронектина (Sigma) в PBS наносили на гидрофобные пластиковые чашки Петри в концентрации 10 мкг/мл на 12 ч при +4 °С. Затем чашки отмывали PBS и, для исключения неспецифического связывания с субстратом, обрабатывали 2 %-ным раствором бычьего сывороточного альбумина (BSA) в течение 1 ч при 37 °С.

Клетки снимали смесью 0.25 %-ного трипсина и 0.02 %-ной ЭДТА в соотношении 3:7.





Суспензию клеток в среде ДМЕМ наносили на гидрофобные чашки Петри (5х106 клеток/чашку), покрытые одним из лигандов, и инкубировали при 37 °С в течение 1 ч в атмосфере 5 % СО2.

Коллаген I типа и ламинин 2/4 были любезно предоставлены Л.В. Кухаревой, И.В.

Воронкиной и Д.В. Гамазиным.

2.3 Выделение клеточных ядер Для получения ядер использовали метод, описанный ранее (Бабаков и др., 2004), с небольшими модификациями. Клетки снимали с чашек при помощи резинового скребка и отмывали в буфере, содержащем 10 мM Tris-HCl pH 8.0, 0.32 M сахарозы, 20 мM MgCl2, 0.1 мM ЭДТА, 10 мM ДТТ, 0.05 мМ PMSF и ингибиторы протеаз (Roche). После центрифугирования клетки ресуспендировали в том же буфере и инкубировали 20–40 мин (до момента лизиса) во льду. Для выделения и очистки ядер клеточный лизат 20 раз пропускали через иглу 21G. Ядра осаждали центрифугированием в течение 5 мин при 2500 g и 4 °C, ресуспендировали и осаждали в 0.5 М сахарозе при тех же условиях. Сохранность и чистоту ядер контролировали под микроскопом. Выделение ядерной белковой фракции, содержащей транскрипционные факторы, проводили в течение 30 мин при температуре 4 °C в буфере, содержащем 400 мM NaCl, 20 мM HEPES pH 7.9, 25 % глицерина, 1.5 мM MgCl, 0.4 мM ЭДТА, 0.4 мM PMSF, 1мM дитиотреитол (ДТТ) и ингибиторы протеаз (Roche). Остатки ядер осаждали центрифугированием (2500 g, 10 мин), супернатант использовали для иммунопреципитации.

2.4 Иммунопреципитация К полученным ядерным лизатам добавляли два объема PBS для уменьшения концентрации соли и инкубировали с протеин-G сефарозой (GE Healthcare) при постоянном перемешивании в течение 1 ч при 4 °C с целью удаления из пробы белков, неспецифически связывающихся с сефарозой. Затем сефарозу осаждали (10000 g, 10 мин, 4 °C), а супернатант переносили в новые пробирки и инкубировали с соответствующими антителами в течение 12 ч при 4 °C. После этого в пробы добавляли свежую порцию сефарозы и инкубировали в течение ч на ротаторе при 4 °C. Иммунопреципитаты отмывали 4 раза раствором PBS с ингибиторами протеаз (Roche).

2.5 SDS-электрофорез и иммуноблот анализ Белки разделяли в градиентном (8 – 18 %) полиакриамидном геле в присутствии SDS (Laemmli, 1970) и переносили на мембрану PVDF (Millipore) по стандартной методике (Towbin et al., 1979). Антитела к -актинину 4, p65, -тубулину, hnRNP A1, hnRNP K/J, hnRNP F/H, hnRNP L, hnRNP C1/C2, hnRNP M1-4 разводили в соотношении 1:500;

с-myc, hnRNP A2/B1, DDX5 – 1:2000;

вторые антитела против IgG мыши, кролика и козы – 1:10000.

Хемилюминесценцию регистрировали с применением установки ChemiDoc XRS (BioRad).

2.6 Двумерный электрофорез белков Двумерный электрофорез белков проводили на оборудовании фирмы Amersham в соответствии с рекомендациями производителя. После электрофореза гели инкубировали в течение ночи в фиксирующем буфере (10 %-ная уксусная кислота, 20 %-ный метанол) и окрашивали кумасси (PageBlue Protein Stain, Fermentas) или серебром (Silver stain, Fermentas).

2.7 Масс-спектрометрический анализ Окрашенные пятна вырезали и собирали в отдельные микропробирки. Трипсинолиз белков в геле проводили по описанному ранее методу (Shevchenko et al., 2006) с некоторыми изменениями. Кусочки геля промывали раствором А (50 % ацетонитрила, 25 мM NH4HCO3) дважды по 15 мин. Затем к образцам добавляли ацетонитрил и инкубировали 5 мин для удаления из геля избытка воды. После удаления ацетонитрила пробы сушили в вакуумной центрифуге в течение 15 мин. Карбамидометилирование белков в геле осуществляли по следующей схеме: инкубация в 10 мM ДТТ, 50 мM NH4HCO3 45 мин при 56 °C;

сушка проб раствором ацетонитрила в течение 3 мин с его последующим удалением;

инкубация в смеси мM раствора йодоцетамида и 50 мM NH4HCO3 в течение 45 мин в темноте. Далее пробы последовательно промывали по 10 мин раствором А и ацетонитрилом и сушили в вакуумной центрифуге в течение 15 мин. Затем к образцам добавляли раствор, содержащий 0.005 мг/мкл трипсина (Trypsin Gold, Promega) в 50 мM NH4HCO3 и 10 % ацетонитриле, и оставляли при 4 °C до полного впитывания раствора в гель, после чего смесь термостатировали в течение 3 ч при 37 °C. По прошествии указанного времени к образцам добавляли еще одну порцию раствора трипсина и оставляли еще на 3 ч при той же температуре. По окончании трипсинолиза пептиды экстрагировали из гелей. Для этого в каждую пробирку добавляли буфер для экстракции (5 % трифторуксусной кислоты (TFA) и 50 % ацетонитрила), перемешивали при помощи вортекса в течение 10 мин и переносили жидкую фазу в чистые микропробирки. Процедуру повторяли трижды. Полученные экстракты сушили в вакуумной центрифуге до полного испарения жидкой фазы и затем растворяли в 10 мкл 0.1 %-ной TFA. При помощи колонок ZipTips (Millipore), по протоколу производителя, полученные пробы очищали от избытка солей. С колонок пептиды элюировали 1.5 мкл смеси 70 %-ного раствора ацетонитрила, 5 %-ной TFA, содержащей матрицу CHCA (-циано-гидрокси-коричную кислоту) в концентрации 9 мг/мл, непосредственно на мишень масс-спектрометра.

Масс-спектрометрический анализ MALDI-TOF (матричной лазерной десорбционно ионизационной времяпролетной масс-спектрометрии) осуществляли с помощью прибора «Voyager» фирмы Applied Biosystems. Ионы детектировали в диапазоне отношения молекулярной массы к заряду (m/z) от 700 до 3500. Полученные данные анализировали с использованием программного обеспечения Data Explorer фирмы производителя, белки идентифицировали при помощи программы Mascot с использованием белковой базы данных SwissProt, методом PMF (peptide mass fingerprint).

2.8 Анализ экспрессии генов-мишеней р65 субъединицы NF-B Для анализа экспрессии генов использовали метод обратно-транскриптазной полимеразной цепной реакции (ОТ-ПЦР).

Из чашек Петри с клетками удаляли культуральную среду, а из клеток выделяли тотальную РНК реагентом TriZol (Invitrogene) в соответствии с рекомендациями изготовителя.

Эффективность выделения мРНК определяли с использованием спектрофотометра NanoDrop.

По матрице РНК синтезировали кДНК при помощи набора для обратной транскрипции RevertAid (Fermentas), руководствуясь рекомендациями производителя. Качество и количество полученной кДНК анализировали методом ПЦР с праймерами к 18S рибосомной РНК. ПЦР проводили по стандартной схеме (Bell, 1989) с использованием Taq полимеразы (Fermentas).

Продукты ОТ-ПЦР оценивали методом горизонтального агарозного гель-электрофореза.

Результаты электрофореза визуализировали с применением комплекса ChemiDoc XRS(BioRad).

2.9 Анализ изоформ ACTN4 в клетках А Из клеток линии А431 была выделена тотальная РНК, которую использовали для реакции обратной транскрипции (см. п.2.8). Полученную кДНК амплифицировали методом ПЦР с праймерами к концевым последовательностям гена ACTN4: 5’ CAGGTCGCTCTCGCCATACA 3’ и 5' GCGGCGGAATGGTGGACTA 3’. Продукты ПЦР разделяли в агарозном геле. Различные варианты транскриптов ACTN4 секвенировали при помощи набора для секвенирования DYEnamic ET Terminator Cycle Sequencing Kit (Amersham Pharmacia Biotech) на приборе GE Amersham MegaBace 1000 DNA Sequencer. Результаты анализировали с помощью программного обеспечения MegaBACE Sequence Analyzer.

2.10 Экспрессионные плазмиды Фрагменты ACTN4 размерами 2732 п.н. и 2077 п.н. были встроены в вектор pJET1\blunt с помощью набора GeneJETTM PCR Cloning Kit (Fermentas), согласно протоколу изготовителя.

Полученные генетические конструкции были использованы для клонирования гена ACTN4 в вектор pCS2MT.

Трансфекцию клеток НЕК293 проводили методом кальций-фосфатной преципитации в фосфатно-солевом буфере.

2.11 Статистическая обработка данных и количественный анализ электрофореграмм Результаты иммуноблотинга и электрофореграмм после ПЦР подвергали денситометрическому анализу. Для этого использовали универсальный анализатор ChemoDock (BioRad) и специализированные программные продукты QuantityOne и Scion Image. Подсчет средних значений, 95 %-ных доверительных интервалов, а также парный корреляционный анализ и вычисление рангового коэффициента Спирмена проводили при помощи программных продуктов Origin и Exсel. В работе представлены данные трех и более независимых экспериментов.

3. РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ 3.1 Взаимодействие клетки с белками внеклеточного матрикса влияет на формирование ядерных белковых комплексов -актинина 4 и р65 субъединицы транскрипционного фактора NF-B в клетках линии А На предварительном этапе был разработан метод получения препаратов внеклеточного матрикса. С его помощью обнаружено, что фибробласты из нормальной и поврежденной ткани синтезируют различное количество коллагенов, ламининов и фибронектина. Известно, что состав внеклеточного матрикса определяет функционирование клетки (Benecke et al., 1978). По этой причине на последующих этапах исследования была выбрана модель клеточной адгезии на этих белках внеклеточного матрикса.

Из клеток А431, распластанных на пластике, коллагенах I и IV типов, фибронектине и ламинине 2/4, были выделены ядра и экстрагированы белки фракции транскрипционных факторов. Во всех экспериментальных точках для экстракции белков брали одинаковое количество ядер. Анализ экстрактов показал, что содержание в них р65 и -актинина изменяется при распластывании клеток на различных белках внеклеточного матрикса (рис. 1).

Так, содержание р65 в клетках на коллагенах и ламинине было одинаковым, но больше чем в клетках на пластике и фибронектине. Содержание -актинина 4 в ядрах: минимально при распластывании на пластике, больше и приблизительно одинаково – на коллагенах и фибронектине, максимально – при адгезии на ламинине.

Рис. 1. Содержание -актинина 4 и р65 в ядрах клеток А431 (ядерные экстракты) и в ядерных белковых комплексах, содержащих р65 (IP p65 sc-372), при адгезии к пластику (Пл), коллагену I (К 1), коллагену IV (К 4), фибронектину (Фн) и ламинину 2/4 (Лм).

IP PG – контрольная проба без добавления антител в реакцию иммунопреципитации.

Далее методом иммунопреципитации были получены ядерные белковые комплексы, содержащие р65 субъединицу транскрипционного фактора NF-B. Методом иммуноблоттинга определено наличие -актинина 4 в этих комплексах (рис. 1). Показано, что -актинин 4 входит в состав ядерных белковых комплексов, содержащих р65 субъединицу NF-B, в клетках А431, распластанных на всех исследуемых субстратах. Количество комплексов р65 и включение -актинина 4 в них зависело от типа белка внеклеточного матрикса, с которым взаимодействовали клетки. На основании полученных данных можно утверждать, что изменение микроокружения клетки влияет на содержание -актинина 4 в комплексы р65.

Сравнение наличия -актинина 4 и р65 в ядерных экстрактах и в полученных белковых комплексах р65 позволило установить, что не весь ядерный р65 ассоциирован с этими комплексами. Это объясняется специфичностью антител, используемых для иммунопреципитации к С-концу р65 (SC-372). Вероятно, у части ядерного р65 С-конец конформационно недоступен для связывания антител. Выбор указанного типа антител обусловлен данными об отсутствии -актинина 4 в белковых комплексах р65, полученных иммунопреципитацией N-конца р65 (антитела SC-8008) (Bolshakova et al., 2007). Отмечено, что не весь ядерный -актинин 4 ассоциирован с р65. Это свидетельствует об участии -актинина в различных ядерных белковых комплексах, которые, вероятно, выполняют разные функции.

3.2 Зависимость активности транскрипционного фактора NF-B от содержания актинина 4 в ядерных белковых комплексах р Обнаружение ассоциации -актинина 4 и р65 субъединицы NF-B в клетках, находящихся в различных условиях, привело к необходимости перейти к проверке функциональности такого взаимодействия, то есть к определению возможности участия -актинина 4 в регуляции активности этого транскрипционного фактора. Для этого исследовали уровень экспрессии р65 зависимых генов и сравнивали его с содержанием -актинина 4 в ядрах и в ядерных комплексах р65 субъединицы в клетках А431, культивируемых на пластике, коллагенах I и IV, фибронектине и ламинине 2/4. Методом ОТ-ПЦР проведен анализ уровня экспрессии восьми различных генов-мишеней р65 субъединицы транскрипционного фактора NF-B (рис. 2). Эти гены кодируют белки, принимающие участие в различных клеточных процессах: интерлейкин (IL2), фибронектин (Fn), тенасцин-С (TNC), BCL2-ассоциированный X белок (BAX), SNAIL (SNAI1), циклооксигеназа 2 (PTGS2), фактор роста фибробластов 8 (FGF8), матриксная металлопротеиназа 9 (MMP9).

Рис. 2. Экспрессия генов-мишеней р субъединицы NF-B в клетках А431 при адгезии к пластику (Пл), коллагену I (К 1), коллагену IV (К 4), ламинину 2/4 (Лм) и фибронектину (Фн) Обнаружено, что экспрессия почти всех исследуемых генов зависит от микроокружения клетки. Корреляционный анализ между активностью экспрессии исследуемых генов и содержанием актинина 4 в комплексе с р65 субъединицей (определяли как количественное отношение актинина 4 к р65) показал наличие такой связи для генов BAX (p0.1) и TNC (p0.01) у клеток, культивируемых на всех исследуемых субстратах кроме коллагена IV. Кроме того, только для генов BAX (p0.05) и TNC (p0.01) обнаружена корреляция между их экспрессией и общим содержанием -актинина 4 в ядре. Полученные результаты позволяют предполагать участие актинина 4 в регуляции активности транскрипционного фактора NF-B в отношении указанных генов. Отсутствие подобных связей для других исследуемых генов объясняется возможностью регуляции их активности -актинин-4-независимыми сигнальными путями. Можно допустить, что адгезия к коллагену IV включает дополнительные сигнальные пути, регулирующие экспрессию генов. Следует отметить, что для гена BAX коэффициент корреляции был отрицательным, то есть связь была обратной: увеличение содержания -актинин 4 в ядерных комплексах р65 приводило к снижению экспрессии этого гена. Для гена TNC коэффициент корреляции был положительным, и, следовательно, связь прямой. Эти данные свидетельствуют о возможности участия -актинина 4 как в активации, так и в супрессии активности транскрипционного фактора NF-B.

3.3 Состав ядерных белковых комплексов -актинина Одним из методических подходов для определения функций -актинина 4 в ядре является идентификация белков, образующих с ним комплексы, и экстраполяция известных функций этих белков на -актинин 4.

Из клеток линии А431 были выделены ядра и экстрагированы ядерные белки фракции транскрипционных факторов. Методом иммунопреципитации были получены белковые комплексы, содержащие -актинин 4.

Состав этих комплексов проанализирован двумерным электрофорезом. Анализ гелей, окрашенных методом серебрения (рис.

3 А), позволил установить, что с ядерным -актинином 4 ассоциировано около 50 различных белков.

Рис. 3. Двумерный электрофорез ядерных белковых комплексов, содержащих -актинин Представлены окраски методами серебрения (А) и кумасси (Б). На рисунке Б стрелками отмечены пятна (пробы), которые вырезали для масс спектрометрического анализа.

Следующим этапом данного исследования была идентификация белков, ассоциированных с -актинином 4 в ядре. Для этого разделенные двумерным электрофорезом белки исследуемых комплексов окрашивали кумасси (рис. 3 Б). Данный способ окраски наиболее совместим с последующим масс-спектрометрическим анализом, но менее чувствителен, чем метод серебрения. Поэтому при окрашивание кумасси визуализируются белки, содержание которых в комплексе с -актинином 4 максимально. Окрашенные пятна были вырезаны, а белки, содержащиеся в них, идентифицированы посредством масс-спектрометрии. Результаты анализа методом PMF представлены в таблице 1.

Идентифицированные белки можно разделить на три условные группы: 1) традиционные белки цитоскелета, с которыми -актинин 4 взаимодействует в цитоплазме;

2) белки, чьи функции связаны с метаболизмом мРНК и 3) белки с неизвестными ядерными функциями. К первой группе относится актин, ядерные функции которого наиболее активно исследуются в последние годы. Однако уже сейчас известно об его участии в белковых комплексах, регулирующих активность всех РНК-полимераз, вовлечении актина в процессы сплайсинга и транспорта пре-мРНК и роли актина в организации ядерной архитектуры (Vartainen, 2008;

Percipalle, 2009). Несмотря на то, что тубулин, обнаруженный в комплексе с -актинином 4, традиционно не считается ядерным белком, упоминания об обнаружении его в ядре неоднократно встречалось в литературе (Bergquist et al., 2001). Следует отметить, что каждый год появляются новые данные о ядерной локализации типично цитоскелетных белков.

Вероятно, тубулин тоже может принимать непосредственное участие в ядерных процессах.

Наиболее многочисленной была вторая группа белков, большая часть которых относится к гетерогенному рибонуклеопротеиновому семейству (hnRNP). Среди них были основные комплексообразующие белки рибонуклеопротеиновых субъединиц. Белки, входящие в эту группу, принимают участие во всех этапах созревания пре-мРНК и ее ядерно цитоплазматическом транспорте. Показано участие некоторых из них в процессе транскрипции.

Помимо этих двух групп были идентифицированы белки с неясными ядерными функциями. Среди них пероксиредоксин 1 – фермент с пероксидазной активностью, защищающий клетку от окислительного стресса, который имеет также и ядерную локализацию.

При воздействии на клетку H2O2 пероксиредоксин 1 в цитоплазме регулирует перераспределение NF-B в ядро и участвует в регуляции образования комплекса ДНК-NF-B (Hansen et al., 2007).

Таблица 1.

Результаты MALDI-TOF анализа ядерных белковых комплексов -актинина Молеку- Молеку № лярная -лярная Название белка и номер в базе Swiss Prot Счет Коли- % пятн масса, масса честв Перек а соответ- белка, о рытия ствующа кДа пепти я пятну, -дов кДА -актин, -актин1;

P60709, P63261 119*** 1 40 42 11 Гетерогенный ядерный 156*** 2 55 51 15 рибонуклеопротеин К (hnRNP K);

P Гетерогенный ядерный 121*** 3 65 60 9 рибонуклеопротеин L (hnRNP L);

P -тубулины-1A, 1B, 1C (tubulin alpha-1A, 59* tubulin alpha-1B, tubulin alpha-1C chains) 1;

4 55 50 3 Q71U36, P68363, Q9BQE 216*** 5 55 50 -тубулин (tubulin beta chain);

P07437 22 D-3-фосфоглицериндегидрогеназа (D-3 85*** 6 55 57 9 phosphoglycerate dehydrogenase);

O Поли(С)-связывающий белок 1 (Poly(rC) 69** 7 35 38 4 binding protein 1);

Q Пероксиредоксин-1 (Peroxiredoxin-1);

66** 8 20 22 3 Q ТАР ДНК-связывающий белок 43 (TAR 68** 9 45 45 4 DNA-binding protein 43);

Q Гетерогенный ядерный 178*** 10 35 37 рибонуклеопротеин A2/B1 (hnRNP 11 A2/B1);

P Гетерогенный ядерный 72** 11 40 37 5 рибонуклеопротеин A2/B1 (hnRNP A2/B1);

P Гетерогенный ядерный 212*** 12 40 39 13 рибонуклеопротеин А1 (hnRNP A1);

P Гетерогенный ядерный 72** 13 40 40 7 рибонуклеопротеин А3 (hnRNP A3);

P 14 115 - Не идентифицирован - - 15 65 - Не идентифицирован - - 16 105 - Не идентифицирован - - 17 35 - Не идентифицирован - - В пробах № 1 и 4 с одинаковой вероятностью идентифицированы два и три белка соответственно. Это объясняется высокой степенью гомологии этих белков.

Вероятность ошибки (р) при идентификации белков: * р0.05;

**p0.005;

***p0.001.

Данные масс-спектрометрического анализа были подтверждены методами иммунохимии.

Для этого проведен иммуноблот-анализ ядерных белковых комплексов -актинина 4 с антителами против белков гетерогенного рибонуклеопротеинового комплекса hnRNP A2/B1, A1, K, L (рис. 4 А) и иммунопреципитация ядерных белков с антителами к -тубулину и hnRNP A2/B1 (рис. 4 Б). Было обнаружено, что в ядре присутствуют не только полноразмерная ( кДа), но и две укороченные (75 и 65 кДа) изоформы -актинина 4 (рис. 4 Б). При этом в ядерном иммунопреципитате -тубулина обнаружены только укороченные варианты -актинина 4 (рис. Б). В ядерном иммунопреципитате hnRNP A2/B1 присутствует только полноразмерный актинин 4. Это свидетельствует о том, что -актинин 4 содержится в различных ядерных белковых комплексах, которые, вероятно, выполняют отличные друг от друга функции.

Рис. 4 Подтверждение результатов масс-спектрометрического анализа методами иммунохимии (А) Иммуноблот-анализ содержания белков семейства hnRNP в ядерном экстракте клеток А431 (яд. экстр.) и в ядерных белковых комплексах -актинина 4 (иммунопреципитация – IP);

(Б) Анализ включения -актинина 4 в ядерные белковые комплексы -тубулина и hnRNP A2/B методом иммуноблоттинга с антителами против -актинина 4. IP PG и PG – контроль без добавления в реакцию иммунопреципитации специфических антител.

Рис. 5 В ядерные комплексы -актинина 4 входят белки, участвующие в регуляции сплайсинга пре-мРНК Яд. экстр. – белки, экстрагированные из ядер клеток А431;

IP – иммунопреципитация ядерных белковых экстрактов с антителами против -актинина 4;

-IP – белки, не связавшиеся с антителами в реакции имунопреципитации;

IP PG – контроль без добавления в реакцию иммунопреципитации специфических антител.

Выявление в комплексе с -актинином 4 большого количества белков, вовлеченных в метаболизм РНК, позволило предположить его участие в этих процессах. Для дополнительного подтверждения этой гипотезы методом иммуноблоттинга было проверено участие в ядерных комплексах -актинина 4 ряда белков, не идентифицированных при масс-спектрометрическом анализе, но принимающих участие в сплайсинге мРНК (рис. 5). Установлено, что -актинин ассоциирован с hnRNP M1-4, DDX5, но не с hnRNP F/H. Стоит обратить внимание на то, что часть белков, идентифицированных в этих комплексах, остается в несвязанном с -актинином состоянии (дорожки –IP на рис. 4 Б и 5).

Таким образом, результаты масс-спектрометрического и биохимического анализов ядерных белковых комплексов -актинина 4 указывают на его участие в процессах транскрипции и созревания мРНК.

3.4 Анализ включения различных изоформ -актинина 4 в ядерные белковые комплексы, регулирующие транскрипцию и созревание мРНК При изучении ядерных комплексов -актинина 4 методами иммунохимии было установлено, что в ядрах клеток линии А431 существуют несколько изоформ -актинина 4. Для ответа на вопрос о природе возникновения этих изоформ и для их дальнейшего анализа было проведено исследование набора мРНК -актинина 4 (рис. 6). Установлено, что в клетках А существует несколько мРНК -актинина 4, отличающихся по размеру. Бльшая из них и одна из укороченных (2077 н.) мРНК были выделены, клонированы и секвенированы. Нуклеотидная последовательность мРНК бльшего размера полностью соответствует последовательности мРНК, кодирующей полноразмерный -актинин 4, в то время как у укороченной последовательности отсутствуют экзоны со второго по восьмой. Этот делетированный участок соответствует аминокислотной последовательности двух кальпониновых доменов -актинина 4, отвечающих за связывание с актином. Таким образом, в клетках А обнаружена укороченная изоформа -актинина 4 (ACTN4iso), образованная путем альтернативного сплайсинга и отличающаяся отсутствием двух кальпониновых доменов.

Рис. 6 Анализ изоформ ACTN4 в клетках А431.

Электрофорез продуктов амплификации кДНК с праймерами к концевым последовательностям ACTN 1 – маркер молекулярных весов;

2 – продукт амплификации.

Для определения специфических ядерных функций этих изоформ -актинина 4 клетки линии HEK293 были трансфицированы экспрессионными плазмидами, несущими полноразмерный или укороченный (без кальпониновых доменов – ACTN4iso) варианты актинина 4, слитые с сигнальным пептидом Myc. Из этих клеток были выделены ядра и экстрагированы ядерные белки фракции транскрипционных факторов. Иммунопреципитацией с антителами к сигнальному пептиду Myc получены ядерные белковые комплексы, содержащие экзогенные варианты -актинина 4. С использованием иммуноблоттинга обнаружено, что белки гетерогенного рибонуклеопротеинового семейства A2/B1 и A1 связываются с полноразмерной формой -актинина 4 и не связываются с ACTN4iso (рис.7).

Рис. 7 Включение hnRNP А2/В1 и hnRNP A1 в ядерные белковые комплексы полноразмерной и укороченной изоформ ACTN Гиперэксперессия полноразмерной или укороченной изоформ -актинина 4 не влияет на перераспределение р65 в ядро (А). Белки семейства гетерогенных рибонуклеопротеинов hnRNP A1 и hnRNP A2/B1 связываются с полноразмерной и не связываются с укороченной изоформами -актинина 4 (Б). Дорожки 1, 5 – не трансфицированные клетки;

2, 6 – клетки, трансфицированные плазмидой pCS2MT без вставки;

3, 7 – клетки, гиперэкспрессирующие полноразмерный ACTN4;

4, 8 – гиперэкспрессирующие ACTN4iso;

9 – контроль без добавления в реакцию иммунопреципитации специфических антител.

Полученные результаты позволяют предполагать, что полноразмерная изоформа актинина 4 участвует в процессинге и транспорте мРНК. Функции изоформы -актинина 4 с делецией кальпониновых доменов (ACTN4iso) могут быть связаны с регуляцией транскрипции.

Таким образом, различные изоформы -актинина 4 могут выполнять отличные ядерные функции.

3.5 Влияние гиперэкспрессии изоформ -актинина 4 на активность транскрипционного фактора NF-B Для проверки гипотезы о возможной способности -актинина 4 непосредственно активировать или ингибировать активность транскрипционного фактора NF-B проверено влияние гиперэкспрессии -актинина 4 на активность и распределение р65. Для этого исследования были выбраны клетки линии HEK293, у которых NF-B находится конститутивно в неактивном состоянии в цитоплазме, в отличие от линии А431, для которой характерна постоянная активность р65. Клетки были трансфицированы экспрессионными плазмидами, содержащими полноразмерный -актинин 4 и ACTN4iso. Анализ содержания р65 в цитоплазме и ядре показал, что гиперэкспрессия -актинина 4 не привела к перераспределению р65 в ядро (рис. 7). Методом ОТ-ПЦР проведен анализ экспрессии генов-мишеней р65 субъединицы NF-B у этих клеток. Не обнаружено каких-либо различий в экспрессии этих генов между контрольными клетками и гиперэкспрессирующими полноразмерный -актинин 4 или ACTN4iso. Таким образом, установлено, что гиперэкспрессия -актинина 4 не влияет на активность транскрипционного фактора NF-B и его ядерную транслокацию, что свидетельствует об отсутствии прямого пути активации р65 через изменение содержания актинина 4 в клетке.

4. ВЫВОДЫ 1. Количество -актинина 4 в ядерных белковых комплексах, содержащих р65 субъединицу транскрипционного фактора NF-B отличается при распластывании клетки на различных белках внеклеточного матрикса. Изменение содержания -актинина 4 коррелирует с уровнем экспрессиии генов-мишеней р65 – BAX и TNC, что свидетельствует о возможном участии -актинина-4 в регуляции активности транскрипционного фактора NF-B.

2. Помимо ассоциации с р65 субъединицей NF-B -актинин 4 входит в состав ряда других ядерных комплексов, содержащих около 50 различных белков. Идентификация этих белков методом масс-спектрометрии показала, что в их число входят белки, регулирующие экспрессию генов на уровнях транскрипции и процессинга мРНК.

3. Полноразмерный -актинин 4 и его укороченная изоформа с делецией кальпониновых доменов входят в состав разных белковых комплексов. Полноразмерная изоформа связана с белками гетерогенного рибонуклеопротеинового комплекса, а укороченная – с -тубулином.

4. В клетках HEK-293, в которых NF-В находится в неактивном состоянии, гиперэкспрессия полноразмерной и укороченной изоформ -актинина 4 не приводит к изменению активности NF-B.

5. -Актинин 4 входит в состав ядерных белковых комплексов, регулирующих экспрессию генов на уровнях транскрипции, процессинга и транспорта мРНК. Вероятно, его ядерные функции связаны с участием в этих процессах.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ 1. Хотин М.Г., Туроверова Л.В., Подольская Е.П., Краснов И.А., Соловьева А.В., Аксенова В.Ю., Магнуссон К.-Э., Пинаев Г.П., Тентлер Д.Г. 2009. Исследование ядерных белковых комплексов -актинина 4 методами двумерного электрофореза и масс-спектрометрии.

Цитология, 51 (8): 684–690.

2. Туроверова Л.В., Хотин М.Г., Юдинцева Н.М., Магнуссон К-Э., Блинова М.И., Пинаев Г.П., Тентлер Д.Г. 2009. Метод анализа белков внеклеточного матрикса, синтезируемого клетками в культуре. Цитология, 51 (8): 691-697.

3. Хотин М.Г., Туроверова Л.В., Соловьева А.В., Пинаев Г.П., Тентлер Д.Г. 2010. Содержание альфа-актинина-4 в ядерных белковых комплексах р65 субъединицы NF-kB коррелирует с активностью этого транскрипционного фактора. Цитология, 52 (6): 517.

4. Хотин М.Г., Туроверова Л.В., Аксенова В.Ю., Соловьева А.В., Пинаев Г.П., Тентлер Д.Г.

2010. -Актинин 4 участвует в ядерных белковых комплексах, регулирующих экспрессию генов. Цитология, 52 (3): 267.

5. Аксенова В.Ю., Хотин М.Г., Туроверова Л.В., Пинаев Г.П., Тентлер Д.Г. Исследование ядерных функций актин-связывающего белка альфа-актинина 4 и его участия в регуляции экспрессии генов. Материалы съезда генетиков и селекционеров, посвященного 200-летию со дня рождения Ч.Дарвина, и V съезда Вавиловского общества генетиков и селекционеров. 21 – 27 июня 2009 г., Москва. С.41.

6. Хотин М. Г., Соловьева А. В., Тентлер Д. Г., Туроверова Л. В., Magnusson K. E., Пинаев Г.

П. Экспрессия генов-мишеней р65 субъединицы NF-кB у кератиноцитов человека при культивировании на различных белках ВКМ. Материалы IV съезда Общества биохимиков и молекулярных биологов. 10 – 16 мая 2008 г. Новосибирск. С.184.

7. Хотин М.Г. Анализ состава мультимолекулярных белковых комплексов, содержащих актинин-4 в клеточном ядре, методами масс-спектрометрии. XIII Санкт-Петербургская ассамблея молодых ученых и специалистов. 15 декабря 2008, Санкт-Петербург. С. 8. Спичкина О.С., Хотин М.Г., Соловьева А.В., Тентлер Д.Г., Туроверова Л.В., Блинова М.И., Пинаев Г.П. 2007. Влияние белков внеклеточного матрикса на распределение р субъединицы транскрипционного фактора NF-B и -актинина 4 в ядре кератиноцитов человека. Цитология, 49 (9): 796.

9. Tentler D., Turoverova L., Khotin M., Solovyeva A., Petukhova O., Bolshakova A., Magnusson K., Pinaev G. P. 2007. Extracellular matrix proteins define the composition of nuclear protein complexes with alpha-actinin 4 and NF-kappaB in human keratinocytes. The American society for cell biology abstracts. Mol. Biol. Cell 18 (supl. 1): 431.

СПИСОК ЦИТИРУЕМОЙ ЛИТЕРАТУРЫ Бабаков В.Н., Бобков Д.Е., Петухова О.А., Туроверова Л.В., Кропачева И.В., Подольская Е.П., Пинаев Г.П. 2004.

Актинин-4 и р65-субъединица транскрипционного фактора NF-B солокализуются и совместно мигрируют в ядро в клетках А431 под действием ЭФР. Цитология 46: 1064–72.

Are A.F., Galkin V.E., Pospelova T.V., Pinaev G.P. 2000. The p65/RelA subunit of NF-kappaB interacts with actin containing structures, Exp. Cell Res. 256: 533–44.

Babakov V.N., Petukhova O.A., Turoverova L.V., Kropacheva I.V., Tentler D.G., Bolshakova A.V., Podolskaya E.P., Magnusson K.E., Pinaev G.P. 2008. RelA/NF-kappaB transcription factor associates with alpha-actinin-4. Exp. Cell Res.

314: 1030–8.

Bell J. 1989. The polymerase chain reaction Immunol Today. 10:351–5.

Benecke B.-J., Ben-Zeev A., Penman S. 1978. The control of mRNA production, translation and turnover insuspended and reattached anchorage – dependent fibroblasts. Cell. 14:931–9.

Bergquist J., Gobom J., Blomberg A., Roepstorff P., Ekman R. 2001. Identification of nuclei associated proteins by 2D gel electrophoresis and mass spectrometry. Neurosci. Methods. 109: 3–11.

Bolshakova A., Petukhova O., Turoverova L., Tentler D., Babakov V., Magnusson K.E., Pinaev G. 2007. Extra-cellular matrix proteins induce re-distribution of alpha-actinin-1 and alpha-actinin-4 in A431 cells. Cell Biol. Int. 3: 360–5.

Farrants A.-K. 2008. Chromatin remodelling and actin organization. FEBS L. 582: 2041–50.

Fazal F, Minhajuddin M, Bijli KM, McGrath JL, Rahman A. 2007. Evidence for actin cytoskeleton-dependent and independent pathways for RelA/p65 nuclear translocation in endothelial cells. J. Biol. Chem. 282:3940–50.

Gettemans J., Van Impe K., Delanote V., Hubert T., Vandekerckhove J., De Corte V. 2005. Nuclear actin-binding proteins as modulators of gene transcription. Traffic. 6: 847–57.

Goffart S., Franko A., Clemen C.S., Wiesner R.J. 2006. Alpha-Actinin 4 and BAT1 interaction with the Cytochrome c promoter upon skeletal muscle differentiation. Curr. Genet. 49: 125–35.

Hansen J.M., Moriarty-Craige S., Jones D.P. 2007. Nuclear and cytoplasmic peroxiredoxin-1 differentially regulate NF B activities. Free Rad. Biol. Med. 43: 282–8.

Honda K., Yamada T., Endo R., Ino Y., Gotoh M., Tsuda H., Yamada Y., Chiba H., Hirohashi S. 1998. Actinin-4, a novel actin-bundling protein associated with cell motility and cancer invasion. J. Cell Biol. 140: 1383–93.

Hofmann W.A., Stojiljkovic L., Fuchsova B., Vargas G.M., Mavrommatis E., Philimonenko V., Kysela K., Goodrich J.A., Lessard J.L., Hope T.J., Hozak P., De Lanerolle P. 2004. Actin is part of pre-initiation complexes and is necessary for transcription by RNA polymerase II. Nat. Cell Biol. 6: 1094– Hu P., Wu S., Hernandez N. 2004. A role for beta-actin in RNA polymerase III transcription. Genes Dev. 18: 3010–5.

Laemmli U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature. 227:

680–5.

Lelivre S.A. 2009. Contributions of extracellular matrix signaling and tissue architecture to nuclear mechanisms and spatial organization of gene expression control. Biochim Biophys Acta. 1790:925–35.

Kustermans G., El Mjiyad N., Horion J., Jacobs N., Piette J., Legrand-Poels S. 2008. Actin cytoskeleton differentially modulates NF-kappaB-mediated IL-8 expression in myelomonocytic cells. Biochem. Pharmacol. 76:1214–28.

Percipalle P., Jonsson A., Nashchekin D., Karlsson C., Bergman T., Guialis A., Daneholt B. 2002. Nuclear actin is associated with a specifi c subset of hnRNP A/B-type proteins. Nucleic Acids Res. 30: 1725–34.

Percipalle P. 2009. The long journey of actin and actin-associated proteins from genes to polysomes. Cell Mol Life Sci.

66:2151- Poch M.T., Al-Kassim L., Smolinski S.M., Hines R.N. 2004. Two distinct classes of CCAAT box elements that bind nuclear factor-Y/alpha-actinin-4: potential role in human CYP1A1 regulation. Toxicol. Appl. Pharmacol. 199: 239–50.

Philimonenko V.V., Zhao J., Iben S., Dingova H., Kysela K., Kahle M., Zentgraf H., Hofmann W.A., de Lanerolle P., Hozak P., Grummt I. 2004. Nuclear actin and myosin I are required for RNA polymerase I transcription. Nat. Cell Biol. 6:

1165–72.

Towbin H., Staehelin T., Gordon J. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. U S A. 76: 4350–4.

Vartiainen M.K. 2008. Nuclear actin dynamics – from form to function. FEBS Letters. 582: 2033–40.

Shevchenko A., Tomas H., Havlis J., Olsen J.V., Mann M. 2006. In-gel digestion for mass spectrometric characterization of proteins and proteomes. Nat. Protoc. 1: 2856–60.

------------------------------------------------------------------------------------------------------------------------- Автор выражает глубочайшую признательность проф. Г.П. Пинаеву, Д.Г. Тентлеру, Л.В. Туроверовой, проф. К.Э. Магнуссону, В.Ю. Аксеновой, Е.П. Подольской, А.В. Соловьевой, проф. В.О. Самойлову, А.В. Большаковой, своим родным и близким за помощь и поддержку при выполнении данной диссертационной работы.



 

Похожие работы:





 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.