авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Участие альфа-актинина 4 в регуляции экспрессии генов и контроле сплайсинга мрнк

На правах рукописи

АКСЕНОВА Василиса Юрьевна УЧАСТИЕ АЛЬФА-АКТИНИНА 4 В РЕГУЛЯЦИИ ЭКСПРЕССИИ ГЕНОВ И КОНТРОЛЕ СПЛАЙСИНГА мРНК 03.03.04 – клеточная биология, цитология, гистология

Автореферат диссертации на соискание ученой степени кандидата биологических наук

Санкт-Петербург 2013

Работа выполнена в Федеральном государственном бюджетном учреждении науки Институт цитологии Российской академии наук

Научный консультант: кандидат биологических наук Тентлер Дмитрий Генрихович Институт цитологии РАН

Официальные оппоненты: доктор биологических наук, профессор Корнилова Елена Сергеевна Институт цитологии РАН кандидат биологических наук Голубкова Елена Валерьевна Санкт-Петербургский государственный университет, Биолого-почвенный факультет

Ведущая организация: Федеральный центр крови, сердца и эндокринологии им. В.А. Алмазова

Защита диссертации состоится «31» мая 2013 года в 12 часов на заседании Диссертационного совета Д 002.230.01 на базе Института цитологии РАН по адресу: 194064 Санкт-Петербург, Тихорецкий пр., д.4.

Адрес электронной почты Института: cellbio@mail.cytspb.rssi.ru Сайт: http://www.cytspb.rssi.ru Факс: 8(812) 297-35-

С диссертацией можно ознакомиться в библиотеке Института цитологии РАН.

Автореферат разослан « » апреля 2013 г.

Ученый секретарь диссертационного совета, кандидат биологических наук Е.В. Каминская

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

1.

Актуальность проблемы 1. Изучение роли актинового цитоскелета в регуляции экспрессии генов представляет собой одно из наиболее актуальных направлений в современных исследованиях механизмов передачи сигнала в клетке. За последние несколько лет появилось большое количество экспериментальных данных, описывающих ранее неизвестные функции белков актинового цитоскелета. Эти данные ставят под сомнение прежние представления о том, что цитоскелет выполняет лишь структурные функции. Тем не менее, механизмы, посредством которых белки цитоскелета вовлечены в регуляцию экспрессии генов и механизмы передачи сигнала в клетке, пока недостаточно хорошо изучены.

Актин и актин-связывающие белки, как основные компоненты цитоскелета, являются ключевыми элементами клетки, обеспечивающими поддержание формы клетки, клеточную адгезию, подвижность клетки, активность ионных каналов, секрецию, апоптоз и выживание клеток (Papakonstanti, Stournaras, 2008). К настоящему моменту многие из белков цитоскелета обнаружены в ядре. Показано, что актин принимает участие в процессе элонгации транскрипции, сборке пре-инициирующего комплекса, связывается с первичными транскриптами РНК и участвует в регуляции экспрессии генов (Percipalle, 2013). Актин-связывающие белки, такие как гельзолин, профилин, кофилин, спектрин, филамин, альфа-актинин 4 и некоторые другие, взаимодействуют с транскрипционными факторами и принимают участие в регуляции экспрессии генов, созревании и экспорте мРНК, репарации ДНК, митозе и реорганизации хроматина (Gettemans et al., 2005). Механизмы участия актина и актин-связывающих белков в данных процессах, протекающих в ядре, широко исследуются, что, в свою очередь, помогает продвинуться в понимании основных этапов передачи сигнала от поверхности клетки в ядро.

Альфа-актинин 4 (ACTN4) является актин-связывающим белком спектринового суперсемейства. Он принимает участие в формировании актинового цитоскелета и, как следствие, играет важную роль в формировании фокальных контактов, процессе миграции клеток и цитокинезе (Honda et al., 1998;

Jayadev et al., 2012). Наследственные мутации в последовательности гена ACTN4 приводят к специфическому нарушению развития почек у человека (Weins et al., 2005). Наличие одного из сплайсинговых вариантов ACTN4 связывают с развитием мелкоклеточной формы рака легкого (Honda et al., 2004). Изменение уровня экспрессии ACTN4 отмечено в опухолевых клетках поджелудочной железы (Kikuchi et al., 2008), яичников (Barbolina et al., 2008), мочевого пузыря (Koizumi et al., 2010) и многих других типах раковых клеток.

Полученные ранее данные свидетельствуют о том, что ACTN4 вовлечен в процесс регуляции активности ряда транскрипционных факторов, таких как NF-B (Babakov et al., 2008), MEF2 (Chakraborty et al., 2006) и NF-Y (Poch et al., 2004), а также играет роль коактиватора ядерных рецепторов эстрогена, рецептора активации пероксисом и рецептора ретиноивой кислоты (Khurana et al., 2011, 2012). Эти транскрипционные факторы, в свою очередь, регулируют экспрессию больших групп генов и участвуют в таких процессах, как пролиферация, дифференцировка и апоптоз. Кроме того, ранее было показано, что ACTN4 входит в состав ядерных белковых комплексов, образованных белками рибонуклеопротеинового семейства hnRNP A2/B1, A1, K, M1-4, C1/C2 (Khotin et al., 2010). Эти белки принимают участие во многих этапах процесса созревания мРНК, таких как полиаденилирование, контроль сплайсинга, поддержание стабильности и экспорта мРНК из ядра, а также процессах рекомбинации, регуляции транскрипции и стабилизации структуры теломер (Dreyfuss et al., 2002).

На сегодняшний день остается открытым вопрос о роли ACTN4 в составе вышеуказанных белковых комплексов и участия в процессах, протекающих в ядре и контролируемых этими комплексами. Эти и многие другие вопросы, связанные с неканоническими функциями ACTN4, определили направление наших исследований.



В экспериментах in vitro по коиммунопреципитации было показано взаимодействие ACTN с RelA/p65 субъединицей NF-B (Babakov et al., 2008), а также, что он связывается с консенсусной последовательностью ДНК, регулируемой траскрипционным фактором NF-B (Большакова, 2009).

Эти ранее полученные данные легли в основу более детального исследования функций ACTN4 в регуляции экспрессии генов, регулируемых RelA/p65.

Выявление ACTN4 в составе белковых комплексов с гетерогенными ядерными рибонуклеопротеинами инициировало исследования, связанные с идентификацией процесса, в котором ACTN4 может принимать участие вместе с данной группой белков.

Остается также нерешенным вопрос об импорте ACTN4 в ядро, ввиду отсутствия в структуре ACTN4 классического сигнала ядерной локализации. Это легло в основу третьего направления исследований этой работы, а именно, уточнения механизмов транспорта ACTN4 в ядро и из ядра.

Цели и задачи работы 1. Цель данной работы заключалась в выявлении роли ACTN4 в процессах, протекающих в ядре и регулируемых RelA/p65 субъединицей NF-B и гетерогенными ядерными рибонуклеопротеинами A2/B1 и А1.

Достижение поставленной цели предполагает решение следующих задач:

1. Создать экспрессионные конструкции, кодирующие варианты ACTN4 с делециями N-, С концевых участков и спектриновых доменов белка.

2. Сравнить ядерно-цитоплазматическое распределение экзогенных вариантов ACTN4 с N- и C концевыми делециями и делецией спектриновых повторов в условиях длительного культивирования и при распластывании клеток на белке внеклеточного матрикса фибронектине.

3. Исследовать влияние ACTN4 на степень активации минимального промотора мышиного гена c fos при взаимодействии с RelA/p65 субъединицей NF-B.

4. Провести анализ экспрессии RelA/p65-зависимых генов при оверэкспрессии ACTN4 и RelA/p субъединицы NF-B.

5. Определить влияние N- концевых делеций и делеции спектриновых повторов ACTN4 на регуляцию экспрессии генов, контролируемых RelA/p65 субъединицей NF-B.

6. Исследовать влияние ACTN4 на процесс альтернативного сплайсинга мРНК генов PKM1/PKM и SMN1/SMN2.

7. Проверить наличие сплайсинговой изоформы ACTN4 с делецией кальпониновых доменов белка в нормальных и злокачественных клетках человека.

Основные положения, выносимые на защиту 1. Ядерно-цитоплазматический транспорт ACTN4 определяется более чем одним доменом в 1.

структуре белка.

Спектриновые повторы, N- и C- концевые домены ACTN4 существенны для его 2.

взаимодействия со структурами актинового цитоскелета.

ACTN4 является коактиватором RelA/p65 субъединицы NF-B.

3.

Димеризация и взаимодействие ACTN4 с актином не является необходимым для его функций 4.

как коактиватора RelA/p65 субъединицы NF-B.

ACTN4 не является необходимым элементом комплекса, регулирующего сплайсинг мРНК 5.

генов PKM1/PKM2 и SMN1/SMN2.

6. Изоформа ACTN4 с делецией кальпонин-гомологичных доменов белка является специфичной для клеток линии А431.

1.4 Научная новизна полученных результатов В настоящей работе впервые представлены данные о регуляции экспрессии RelA/p65 зависимых генов, таких как с-fos, металлопротеиназы 3-го (MMP-3) и 1-го (ММР-1) типов, посредством актин-связывающего белка альфа-актинина 4 (ACTN4). Проведен анализ влияния делеционных вариантов ACTN4 на экспрессию гена MMP-3 в сравнении с полноразмерным вариантом ACTN4. Показано, что ACTN4 с делецией спектриновых и кальпониновых доменов сохраняет способность регулировать экспрессию гена MMP-3, что, в свою очередь, позволяет сделать предположение о том, что ACTN4 в ядре потенциально может функционировать в виде мономера. Впервые проведен анализ влияния ACTN4 на процесс альтернативного сплайсинга генов PKM1/PKM2 и SMN1/SMN2, регуляция сплайсинга которых опосредована hnRNP A2/B1 и А1. Показано, что делеции спектриновых повторов белка и N-концевого участка, включающего домены связывания с актином, не препятствуют перемещению ACTN4 в ядро, а для экспорта ACTN4 из ядра достаточно одной из двух идентифицированных NES-последовательностей в ACTN4.

1.5 Теоретическое и практическое значение работы Полученные результаты имеют фундаментальное значение для понимания механизмов участия белков цитоскелета в процессах, протекающих в ядре, таких как, регуляция транскрипции и сплайсинг пре-мРНК. В связи с тем, что мутации в гене ACTN4 приводят к развитию фокально сегментарного гломерулосклероза – заболевания, связанного с нарушением нормального функционирования подоцитов, а оверэкспрессия ACTN4 отмечена при многих злокачественных заболеваниях, исследование функций ACTN4 приобретает не только фундаментальный, но и прикладной характер. Кроме того, данные, полученные в ходе исследовательской работы, могут быть использованы для включения их в учебные пособия и курсы лекций Санкт-Петербургского государственного университета, Санкт-Петербургского государственного технологического университета, Санкт-Петербургского государственного политехнического университета и других вузов с факультетами биологического профиля.

Личный вклад автора 1. Все исследования, проведенные в работе, в том числе обработка результатов, выполнены лично автором. Анализ изоформ ACTN4 в клетках А431 и ядерно-цитоплазматического распределения RelA/p65 субъединицы NF-B в клетках линии НЕК293Т проведено совместно с Хотиным М.Г. Во всех совместных работах вклад автора был определяющим. Материалы, вошедшие в представленную работу, обсуждались и публиковались совместно с соавторами и научным руководителем.

Апробация работы 1. Материалы диссертации были представлены на V съезде Вавиловского общества генетиков и селекционеров (Москва, 2009), VIII Международном конгрессе медицинских наук (ICMS) (София, 2009), Международном молодежном симпозиуме и конгрессе FEBS (Гетеборг, 2010), 2-ой Молодежной конференции Института цитологии РАН (Санкт-Петербург, 2010), XVI Всероссийском симпозиуме «Структура и функции клеточного ядра» (Санкт-Петербург, 2010), 3 ей Конференции молодых ученых Института цитологии РАН (Санкт-Петербург, 2012).

Финансовая поддержка работы 1. Работа выполнена при финансовой поддержке Федеральной целевой программы «Научные и научно-педагогические кадры инновационной России» (2009-2013), РФФИ (мол_а 12-04-32194, 13-04-00497 A_2013), Европейского биохимического общества Collaborative Experimental Scholarship for Central & Eastern Europe, Carl Zeiss, гранта Правительства Российской Федерации № 11.G34.31.0069 и программы Visby Шведского института.

Публикации 1. По теме диссертации опубликовано 11 печатных работ, из которых 4 статьи в рецензируемых журналах и 7 тезисов.

1.10 Объем и структура диссертации Диссертация состоит из введения, обзора литературы, описания материалов и методов исследований, результатов и их обсуждения, выводов и списка цитируемой литературы, включающего 162 источника. Диссертация изложена на 114 страницах машинописного текста.

Иллюстративный материал содержит 18 рисунков и 7 таблиц.

МАТЕРИАЛЫ И МЕТОДЫ 2.

2.1 Клеточные культуры Клетки эпидермоидной карциномы А431 были получены из Российской коллекции клеточных культур Института цитологии РАН (Санкт-Петербург, Россия). Клетки эмбриональной почки человека НЕК293T любезно предоставлены д.б.н. А.Н. Томилиным (Институт цитологии РАН, Санкт-Петербург, Россия). Описанные типы клеток культивировали в среде DMEM (Биолот) с добавлением 10 % телячьей сыворотки (Sigma), L-глутамина (Gibco), 200 ед./мл пенициллина и 200 мкг/мл стрептомицина (Gibco) (далее по тексту – полная среда культивирования) в атмосфере 5 % CO2 при 37 С.

Первичная культура кератиноцитов, полученных по методу Рейнвальда с модификациями (Блинова и др., 2002), и фибробластов, полученных методом миграции клеток из фрагментов нормальной кожи взрослых доноров (Юдинцева и др., 2008), были любезно предоставлены группой клеточной биотехнологии к.б.н. М.И. Блиновой.

Клеточный материал для получения белковых лизатов линий SK-MEL5, A375, A375P, WM2664, SK-MEL28, HS-695T, UMUC-3, J82, H522, A549, H520, H1299, H1650, H358, H23, H460, MCF7, MDA-468, MDA-MB-231, BxPC-3, PANC-1, MIA PaCa-2, AsPC-1 были любезно предоставлен доктором Е. Тульчинским (Университет г.Лестер, Великобритания).

Генетические конструкции 2. Плазмида pCX-EGFP - 5510 п. о. (любезно предоставлена д.б.н. А.Н.Томилиным (Институт цитологии РАН, Санкт-Петербург, Россия), содержит ген eGFP под контролем CMV промотора;

ген устойчивости к ампициллину.

Генетические конструкции, кодирующие RelA/p65 и p50 под контролем CMV промотора, и pfLUC кодирующая ген люциферазы под контролем минимального промотора (c -56-го по +109-ое положение относительно начала инициации транскрипции) мышиного гена c-fos и pcDNA3.0, были любезно предоставлены доктором Е. Тульчинским (Университет г. Лестер, Великобритания).

Плазмида pCMV-LacZ содержит ген, кодирующий бета-галактозидазу под контролем CMV промотора, и ген устойчивости к ампициллину (любезно предоставлена д.б.н. Н. А. Барлевым, Институт цитологии РАН, Санкт-Петербург, Россия).

Плазмида pCS2MT – 4352 п. о. (любезно предоставлена д.б.н. А.Н. Томилиным (Институт цитологии РАН, Санкт-Петербург, Россия), содержит CMV промотор, ген устойчивости к ампициллину, 6 раз повторенную последовательность MYC-Tag. На основе вектора pCS2MT были сконструированы экспрессионные плазмиды pCS2MT-ACTN4Fl, pCS2MT-ACTN4delCH1-2, pCS2MT-ACTN4delSR1-4, pCS2MT-ACTN4delN, pCS2MT-ACTN4delC и pCS2MT-ACTN4delEF2.

Клонирование фрагментов, кодирующих различные домены ACTN4, в вектор pCS2MT проводили по сайтам рестрикции EcoRI и XbaI, c расположением последовательности, кодирующей маркерный пептид Myc, на N-конце всех вариантов кДНК. Клонирование полноразмерного ACTN проводили с помощью кДНК, предварительно полученной в ходе реакции обратной транскрипции с помощью олиго(dT)праймеров из тотальной РНК клеток эпидермоидной карциномы А431.

Реакцию обратной транскрипции проводили согласно протоколу фирмы-производителя для набора Revert Aid First Strand cDNA Synthesis Kit (Fermentas, Литва). Амплификация фрагментов ACTN4 была произведена с помощью метода ПЦР с использованием Pfu ДНК-полимеразы.

Полученные варианты кДНК были секвенированы с помощью набора для секвенирования DYEnamic ET Terminator Cycle Sequencing Kit (Amercham Pharmacia Biotech) на приборе GE Amersham MegaBACE 1000.





Анализ экспрессии генов, регулируемых RelA/p65 субъединицей NF-B 2. Для анализа уровня экспрессии генов был использован метод полуколичественной ОТ-ПЦР (обратно транскриптазная полимеразная цепная реакция).

Клетки линии НЕК293Т трансфицировали экспрессионными плазмидами, кодирующими RelA/p65 и ACTN4. Трансфекцию проводили в 6-луночных планшетах (Nunc). За день до проведения трансфекции клетки рассевали в плотности 2.4105 кл./лунку в полной среде культивирования. За два часа до проведения трансфекции проводили смену культуральной среды на свежую. Процедуру трансфекции проводили при помощи реагента Turbofect (Thermofisher) согласно рекомендациям фирмы-производителя. На следующий день после проведения трансфекции снова проводили смену среды на свежую. Через 67 ч после проведения трансфекции удаляли среду для культивирования, клетки промывали буфером PBS и выделяли тотальную РНК c последующим получением кДНК, как было описано ранее. В реакцию обратной транскрипции брали 2500 нг РНК. Анализ качества и количества выделенной РНК проводили при помощи спектрофотометра NanoDrop (Thermofisher) и методом ПЦР с помощью праймеров к мРНК гена 18S рибосомной РНК и мРНК гена GAPDH. Реакцию ПЦР проводили согласно протоколу, предлагаемому компанией Fermentas, в однократном реакционном буфере для Taq ДНК полимеразы, с содержанием 0.2 мМ dNTP, 2 мМ MgCl2, 1 мкМ каждого праймера и 0.1 ед. акт. Taq ДНК-полимеразы. Продукты ОТ-ПЦР разделяли методом горизонтального агарозного электрофореза с последующей визуализацией на приборе Chemidoc XRS (BioRad) и при помощи пакета программного обеспечения Quantity One 1-D. Статистическое сравнение средних трех и более независимых экспериментов проводили с помощью t-теста Стьюдента.

Иммунофлуоресценция 2. Трансфицированные экспрессионными конструкциями, клетки линии НЕК293Т в количестве 1.6105 кл./мл наносили на покровные стекла, покрытые поли-D-лизином (P7280, Sigma) или силиконизированные, покрытые белком внеклеточного матрикса фибронектином (F0895, Sigma).

Трансфекцию клеток НЕК293Т проводили при помощи реагента Turbofect (Thermofisher) согласно рекомендациям производителя. Через 24 ч после проведения трансфекции, клетки снимали раствором трипсин-версена (1:3) (Биолот) и культивировали в течение 24 ч на стеклах, покрытых поли-D-лизином, или в течение 1 ч на стеклах, покрытых фибронектином, при 37 С в атмосфере 5 % СО2. Далее клетки фиксировали в 10 %-ном растворе формалина, приготовленном на PBS, в течение 15 мин и проводили пермеабилизизацию в 0.1 %-ном растворе тритона Х-100, приготовленном на PBS, в течение 6 мин. Перед инкубированием препаратов со специфическими антителами, стекла обрабатывали 2 %-ным раствором BSA (Sigma) в течение 30 мин для уменьшения неспецифического связывания. Выявление локализации экзогенных вариантов ACTN4 проводили с помощью мышиных моноклональных антител против маркерного пептида MYC (M4439, Sigma) и вторичных антител, конъюгированных с флуоресцентным красителем FITC, против иммуноглобулинов мыши (A21200, Invitrogen). Инкубирование с антителами проводили в течение 40 мин при комнатной температуре. По истечении этого времени клетки промывали три раза раствором PBS, содержащем 0.1 % Tween-20. Цитоскелет окрашивали 20 % ным раствором родамин-фаллоидина, ядра раствором DAPI (1 мкг/мл). Фиксацию препаратов осуществляли в заключающей среде Mounting Medium (Vector Laboratories). Препараты исследовали с помощью лазерного конфокального микроскопа TCS SP5 (Leica). Применяли раздельное сканирование сигналов для FITC (488 нм), родамин-фаллоидина (543 нм) и DAPI ( нм) с последующим совмещением сигналов при поддержке программного обеспечения Leica TCS.

Изображения получали, используя масляный инвертированный объектив с увеличением 100х.

Люциферазный тест на активность RelA/p 2. Клетки А431 рассевали в плотности 6104 кл./лунку в 24-х луночном планшете за день до проведения трансфекции. Клетки культивировали при 37 C в атмосфере 5 % CO2 до достижения 90-95 % монослоя на полной среде культивирования. Трансфекцию клеток А431 проводили при помощи реагента Lipofectamine 2000 (11668-027, Invitrogen) согласно рекомендациям фирмы-производителя. В связи с токсичностью реагента для клеток А431 трансфекцию проводили на среде Opti-MEM (Gibco) без антибиотиков и через 6 ч после проведения трансфекции проводили смену среды на свежую полную среду. Общее количество ДНК при проведении трансфекции составляло 3000 нг/лунку, экспрессионный вектор pcDNA3.0 был использован для поддержания одинаковой нагрузки ДНК во всех лунках. Анализ влияния ACTN4 на активность RelA/p65 субъединицы NF-B проводили с помощью вектора pfLUC, содержащего ген люциферазы под контролем минимального мышиного промотора гена c-fos (-56-го по +109-ое положение относительно старта инициации транскрипции). Через 30 ч после проведения трансфекции, клетки лизировали в однократном лизирующем буфере (6.25 мМ Трис-HCl pH 7.8, 10 мМ ДТТ, 10 мМ ЭДТА, 50 % глицерол, 5 % Тритон X-100). Активность люциферазы определяли с помощью набора Luciferase assay (К801-200, BioVision). Реакцию проводили из расчета 100 мкл субстрата А (входит в состав набора) и 100 мкл субстрата В (входит в состав набора) на 20 мкл лизата. Активность люциферазы определяли при помощи люменометра Victor X5 (Perkin Elmer). Результаты люциферазного теста нормализовали относительно экспрессии бета галактозидазы. Активность бета-галактозидазы измеряли при длине волны 405 нм после предварительной инкубации в течение 15 мин при 37 С 80 мкл лизата и 100 мкл буфера для бета галактозидазы (60 мМ Na2HPO4, 40 мМ NaH2PO4, 10 мМ KCl, 1 мМ MgCl2, 0.35 % бета меркаптоэтанол, 0.2 % о-нитрофенил--галактопиранозид).

Выделение белков 2. Экстракты из культур клеток А431, НЕК293Т, SK-MEL5, A375, A375P, WM2664, SK MEL28, HS-695T, UMUC-3, J82, H522, A549, H520, H1299, H1650, H358, H23, H460, MCF7, MDA 468, MDA-MB-231, BxPC-3, PANC-1, MIA PaCa-2, AsPC-1 получали путем лизиса клеток в буфере, содержащем 6.25 мМ Трис-HCl pH 7.8, 10 мM ДТТ, 10 мM ЭДТА, 50 % глицерол, 5 % Тритон X-100 и ингибиторы протеаз 1:50 (04 693 132 001, Roche), в течение 20 мин при +4 С и двух последующих этапов замораживания-оттаивания при -80 С/+4 С. Экстракты белков смешивали с пятикратным буфером Laemmli (60 мМ Трис-HCl, 2 % SDS, 10 % глицерол, 5 % ДТТ, 0.01 % бромфенол) в соотношении 1:5 и проводили денатурацию в течение 7 мин при 98 С.

Для получения цитоплазматических и ядерных лизатов клетки, перед снятием с флаконов, промывали буфером PBS, нагретым до 37 С, для удаления остатков среды. Затем клетки снимали при помощи резинового скребка и отмывали в буфере, содержащем 10 мM Трис-HCl pH 8.0, 0. M сахарозы, 20 мM MgCl2, 0.1 мM ЭДТА, 1 мM ДТТ, 0.05 мМ PMSF и ингибиторы протеаз (Бабаков и др., 2004). После центрифугирования клетки ресуспендировали в том же буфере и инкубировали 20–40 мин (до момента лизиса) во льду. Для выделения и очистки ядер клеточный лизат 20 раз пропускали через иглу 21G. Ядра осаждали центрифугированием в течение 5 мин при 3000 g и 4 С, ресуспендировали и очищали, осаждая в 0.5 М сахарозе при тех же условиях.

Сохранность, чистоту и количество ядер контролировали под микроскопом в камере Горяева.

Выделение ядерной белковой фракции, содержащей транскрипционные факторы, проводили в течение 30 мин при температуре 4 С в буфере, содержащем 400 мM NaCl, 20 мM HEPES pH 7.9, 25 % глицерина, 1.5 мM MgCl2, 0.4 мM ЭДТА, 0.4 мM PMSF, 1 мM ДТТ и ингибиторы протеаз, с последующим центрифугированием в течение 10 мин при 10 000 g. Экстракты белков смешивали с пятикратным буфером Laemmli (60 мМ Трис-HCl, 2 % SDS, 10 % глицерол, 5 % ДТТ, 0.01 % бромфенол) в соотношении 1:5 и проводили денатурацию в течение 7 мин при 98 С.

Иммунопреципитация 2. К цитоплазматическим лизатам, полученным как описано выше, добавляли протеин G сефарозу (GE Healthcare) и инкубировали при постоянном перемешивании в течение 2 ч при 4 С для удаления из пробы белков, неспецифически связывающихся с сефарозой. Затем сефарозу осаждали (2000 g, 3 мин, 4 С), а супернатант переносили в новые пробирки и инкубировали с антителами к RelA/p65 субъединице NF-B, коньюгированными с протеин G-сефарозой (sc- AC, в соотношении 1:200), в течение ночи. На следующий день, иммунопреципитаты отмывали раза буфером PBS, содержащим ингибиторы протеаз, на льду, смешивали с пятикратным буфером Laemmli (60 мМ Трис-HCl, 2 % SDS, 10 % глицерол, 5 % ДТТ, 0.01 % бромфенол) в соотношении 1:5 и проводили денатурацию в течение 7 мин при 98 С.

SDS-электрофорез и иммуноблоттинг 2. Белковые пробы разделяли в ПААГ, содержащем 10 % SDS, при силе тока 100 мА/см2 в течение 1-2 ч в однократном трис-глициновом буфере с 0.1 %-ным содержанием SDS. Гель, после проведения электрофореза, инкубировали в однократном буфере для переноса pH 8.3 c 10 %-ным содержанием метанола в течение 1 ч. Перенос белков с геля на мембрану PVDF (Millipore) проводили в течение ночи в трис-глициновом буфере при силе тока 20 мА/см2. Предварительно мембрану фиксировали в метаноле в течение 1 мин и высушивали при комнатной температуре.

Перед инкубированием мембраны с антителами ее предварительно инкубировали в течение 1 ч в %-ном растворе молока, приготовленного на буфере PBST (PBS, содержащий 0.1 % Tween-20).

После этого мембрану отмывали буфером PBST и инкубировали в течение ночи со специфическими первичными антителами при 4 С. Далее мембрану трижды отмывали буфером PBST, инкубировали 1 ч со специфическими вторичными антителами, конъюгированными с пероксидазой хрена, проводили шестикратную отмывку буфером PBST и визуализировали с помощью люминофора ECL (1.25 мМ люминол, 0.2 мМ паракумаровая кислота и 0.01 % Н2О2 в 150 мМ Трис-HCl pH 8.8). Хемилюминисценцию регистрировали на приборе Chemidoc XRS (BioRad).

Моноклональные мышиные антитела к маркерному пептиду MYC (M4439, Sigma) разводили в соотношении 1:2000;

кроличьи поликлональные антитела к р65 субъединице транскрипционного фактора NF-B (sc-372, Santa Cruz Biothechnology) – 1:300;

мышиные моноклональные антитела к актину (AC-17;

Sigma) – 1:1000;

кроличьи поликлональные антитела к ACTN4 (IG701, ImmunoGlobe);

кроличьи моноклональные антитела к GAPDH (14С10, Cell Signaling) – 1:1000;

антитела против иммуноглобулинов мыши (A9044, Sigma) и кролика (A0545, Sigma), коньюгированные с пероксидазой хрена, – 1:10000;

антитела против иммуноглобулинов мыши (A21200, Invitrogen) и кролика (A11008, Invitrogen), коньюгированные с флуоресцентным красителем Alexa Fluor 488, – 1:350.

Анализ влияния оверэкспрессии ACTN4 на процесс сплайсинга генов 2. PKM1/PKM2 и SMN1/SMN Анализ влияния оверэкспрессии ACTN4 на процесс альтернативного сплайсинга генов PKM1/PKM2 и SMN1/SMN2 проводили методом ОТ-ПЦР с последующим рестрикционным анализом полученных фрагментов. Трансфекцию клеток HEK293T и А431 проводили при помощи реагента для трансфекции Lipofectamin 2000 (Invitrogen), согласно протоколу фирмы-производителя, выделение РНК и клеточных экстрактов – методом, описанным выше.

Качество и количество полученной с помощью олиго(dT)праймеров кДНК до проведения ПЦР оценивали с помощью праймеров к мРНК гена GAPDH.

Для проведения ПЦР кДНК гена PKM были использованы пары праймеров F_PKM 5’ CTGAAGGCAGTGATGTGGCC 3’ (прямой) и R_PKM 5’ ACCCGGAGGTCCACGTCCTC 3’ (обратный) (Chen et al., 2010). Далее, полученный фрагмент размером 442 п.н. обрабатывали рестриктазой Pst1 и анализировали соотношение фрагментов, соответствующих PKM1 варианту (442 п.н.) и PKM2 варианту (246 п.н., 196 п.н.).

Для проведения ПЦР кДНК гена SMN были использованы пары праймеров F_SMN 5’ CTCCCATATGTCCAGATTCTCTT 3’ (прямой) и R_SMN 5’ CTACAACACCCTTCTCACAG 3’ (обратный). После проведения ПЦР полученные фрагменты размером 505 п.н. (SMN1/2) и 451 п.н.

(SMN2) обрабатывали рестриктазой DdeI и анализировали соотношение фрагментов 505 п.н., соответствующих SMN1 варианту, 382 п.н., 123 п.н., соответствующих полноразмерному SMN варианту и 328 п.н., 123 п.н., соответствующих укороченному SMN2 варианту.

Анализ продуктов амплификации и рестрикционных фрагментов проводили методом электрофореза в 6 %-ном ПААГ в однократном трис-боратном (TBE) буфере. Подтверждение оверэкспрессии ACTN4Fl проводили методом иммуноблот-анализа с антителами против маркерного пептида MYC.

Статистическая обработка данных люциферазного теста, электрофореграмм, 2. иммуноблоттинга Результаты люциферазного теста на активность RelA/p65 выражали как отношение люминисценции к активности бета-галактозидазы. Данные трех и более повторностей каждого эксперимента приводили как среднее значение ±SD (стандартное отклонение). Статистическую значимость разницы между средними определяли с помощью t-теста Стьюдента.

Результаты иммуноблоттинга и электрофореграмм после ПЦР анализировали методом денситометрического анализа с помощью пакета программного обеспечения Quantity One 1-D прибора Chemidoc XRS (BioRad).

3. РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ 3.1 Делеционное картирование ACTN ACTN4 как белок актинового цитоскелета играет ключевую роль в процессе перестройки актинового цитоскелета, формировании выпячиваний и адгезии клеток к внеклеточному матриксу.

Преимущественно, ACTN4 локализован в цитоплазме, однако в некоторых типах раковых клеточных линий отмечена его ядерная локализация (Honda et al., 1998;

Hara et al., 2007;

Khotin et al., 2010). Кроме того, перемещение ACTN4 в ядро происходит при обработке клеток цитохолазином Д – агентом, подавляющим полимеризацию мономеров актина, и ингибиторами PI3-киназы (Honda et al., 1998;

Бабаков и др., 2004). Cледует также отметить, что ACTN4 не содержит классического сигнала ядерной локализации, и механизмы его транспорта в ядро исследованы не полностью. В связи с этим одной из задач данной работы было выявление участков ACTN4, которые могут участвовать в ядерных функциях белка и отвечать за его перемещение в ядро. Выбор участков для проведения делеционного картирования ACTN проводили на основании данных о функциях ACTN4 в цитоплазме, а также данных по взаимодействию ACTN4 c его ядерными белковыми партнерами.

Клонирование кДНК полноразмерного ACTN4, так же, как и создание делеций в последовательности ACTN4, было выполнено методом ПЦР, с помощью специфических пар праймеров. В ходе клонирования ACTN4 в клетках А431 была идентифицирована новая изоформа мРНК (рис. 1, А, Б, В, Г). Методом секвенирования была установлена нуклеотидная последовательность данной изоформы и было выявлено, что она образуется в результате альтернативного сплайсинга пре-мРНК гена ACTN4 путем вырезания участка со 2-го по 8-й экзон включительно (рис. 1, Д). Данные о структуре выявленной изоформы ACTN4 были внесены в единый реестр базы данных NCBI, которому был присвоен персональный идентификационный номер GeneBank GU 987085 (Аксенова и др., 2012).

Отсутствие кальпониновых доменов в структуре обнаруженной нами изоформы, в свою очередь, определило ее последующее изучение в качестве делеционного варианта ACTN4, потенциально не способного взаимодействовать с F-актином.

Таким образом, в ходе работы были созданы экспрессионные конструкции: pCS2MT ACTN4Fl, pCS2MT-ACTN4delCH1-2 (ACTN4 с делецией кальпониновых доменов белка), pCS2MT-ACTN4FldelN (делеция 1-го – 294-й а.о.), pCS2MT- ACTN4FldelC (делеция 753-го – 911 й а.о.), pCS2MT- ACTN4FldelEF2 (делеция 806-го – 911-й) и pCS2MT-ACTN4FldelSR1-4 (делеция 293-го – 752-й а.о.). Анализ нуклеотидной последовательности, точность встраивания и отсутствие сдвига рамки считывания проверяли методом ПЦР и секвенированием, с последующим анализом спектра нуклеотидной последовательности в программном обеспечении Sequence Scanner (Applied Biosystems) и NCBI Blast. Теоретическое определение молекулярной массы экзогенных вариантов ACTN4 проводили с помощью ExPASy Proteomics Server, Science Gate Protein Molecular Weight Calculator. Подтверждение экспрессии полноразмерного и делеционных вариантов ACTN проводили с помощью SDS-ПААГ электрофореза и иммуноблоттинга с антителами против маркерного пептида MYC, расположенного с N-конца относительно последовательности ACTN4.

Рис. 1. Структура полноразмерной и сплайсинговой изоформ ACTN4 (A) и делеционных вариантов ACTN (Б). (В) иммуноблоттинг ядерного лизата клеток А431 с антителами против ACTN4, стрелками указаны полноразмерная и укороченная изоформы. (Г) ОТ-ПЦР с кДНК гена ACTN4 в клетках A431;

стрелками указаны полосы на дорожках, соответствующие полноразмерной ACTN4Fl (2736 п.о.) и укороченной изоформе ACTN4Iso (2079 п.о.). (Д) спектры, соответствующие району делеции в ACTN4Fl и ACTN4Iso.

3.2 Ядерно-цитоплазматическое распределение экзогенных вариантов ACTN Внутриклеточную локализацию экзогенных вариантов ACTN4 определяли методом иммунофлуоресценции с помощью специфических антител против маркерного пептида MYC.

Клетки HEK293T после проведения трансфекции культивировали на покровных стеклах, предварительно покрытых поли-D-лизином и белком внеклеточного матрикса – фибронектином.

Согласно полученным результатам, внутриклеточное распределение экзогенного ACTN4Fl соответствовало локализации эндогенного ACTN4 (рис. 2, ряд А, поли-D-лизин). Делеция двух кальпониновых доменов белка, N-конца и SR-доменов приводила к значительному накоплению белка в ядре и нарушению взаимодействия со структурами актинового цитоскелета (рис. 2, ряд Б, В, Г, поли-D-лизин). Внутриклеточное распределение вариантов ACTN4 с делецией EF2 и делецией всего С-концевого домена было сходным с внутриклеточным распределением полноразмерного ACTN4Fl, с небольшим отличием в том, что оба делеционных варианта частично взаимодействовали с актиновым цитоскелетом и частично имели диффузное распределение в цитоплазме (рис. 2, ряд Д, Е).

Поскольку ACTN4 является одним из ключевых элементов в процессе формирования фокальных контактов, распластывания клеток и их пролиферации, то перевод клеток в суспензионное состояние, изменение условий культивирования или смена типа субстрата для распластывания могут влиять на характер внутриклеточного распределения ACTN4. Чтобы понять, является ли выявленная нами внутриклеточная локализация делеционных вариантов ACTN4 при культивировании клеток на поли-D-лизине универсальной или же делеционные варианты ACTN4 могут иметь другое ядерно-цитоплазматическое распределение, клетки, после проведения трансфекции, распластывали на фибронектине. Результаты анализа иммунофлуоресценции показали, что для ряда делеционных вариантов при распластывании клеток на фибронектине внутриклеточное распределение ACTN4 сильно меняется. При анализе внутриклеточного распределения делеционных вариантов ACTN4delN, ACTN4delCH1-2 и ACTN4delSR1-4 (рис. 2, ряд Б, В, Г, фибронектин) было показано, что их локализация стала цитоплазматической вместо ядерной, а варианты ACTN4delC и ACTN4delEF2 (рис. 2, ряд Д, Е, фибронектин) сохранили прежнюю локализацию. Это говорит о том, что выявленная нами ранее внутриклеточная локализация делеционных вариантов ACTN4 при условии культивирования клеток на поли-D-лизине не является универсальной и может изменяться при распластывании на белках внеклеточного матрикса.

Стоит отметить, что, несмотря на сохранение кальпониновых доменов, при делеции спектриновых доменов функции ACTN4 как актин-связывающего белка нарушаются практически полностью, в отличие от С-концевых делеций. Этот факт, по всей видимости, связан с тем, что ACTN4 в цитоплазме работает в виде димера, и делеция доменов, обеспечивающих его формирование, является критичной для взаимодействия с фибриллярным актином (Aksenova et al., 2013).

3.3 Влияние ACTN4 на степень активации минимального промотора мышиного гена c-fos RelA/p65 субъединицей NF-B Для того чтобы определить влияние ACTN4 на RelA/p65 в отношении активации им минимального промотора мышиного гена c-fos, нами была проведена трансфекция клеток линии А431. Клетки трансфицировали репортерной конструкцией, кодирующей ген люциферазы под контролем мышиного промотора гена c-fos (с -56-го по 109-ое положение) отдельно и в сочетании с плазмидами, кодирующими RelA/p65 и р50 субъединицы NF-B, ACTN4 и бета- галактозидазу, с последующим анализом уровня люминисценции через 30 ч после проведения трансфекции.

Согласно полученным результатам, оверэкспрессия RelA/p65 приводила к значительному увеличению уровня люминисценции, интенсивность которой служила показателем степени активации промотора. В то время как при совместной оверэкспрессии RelA/p65 субъединицы с p50 субъединицей NF-B происходило существенное снижению уровня люминисценции (рис. 3, A). Оверэкспрессия ACTN4 не приводила к активации промотора гена с-fos, однако оверэкспрессия ACTN4 совместно с RelA/p65 способствовала активации промотора и увеличению интенсивности люминисценции в сравнении с оверэкспрессией одного RelA/p65 (P0.02).

Подтверждение оверэкспрессии ACTN4 проводили методом иммуноблоттинга клеточных лизатов, после разделения их в SDS-ПААГ, с антителами против маркерного пептида MYC (рис. 3, А, нижняя панель). Таким образом, данные результаты свидетельствуют о том, что ACTN4 может играть роль коактиватора RelA/p65 в отношении минимального промотора мышиного гена c-fos (Aksenova et al., 2013).

3.4 Анализ воздействия оверэкспрессии ACTN4 и RelA/p65 субъединицы NF-B на экспрессию RelA/p65-зависимых генов Исходя из того, что ACTN4 принимает участие в RelA/p65-зависимой регуляции экспрессии мышиного гена c-fos, нами было принято решение проанализировать влияние совместной оверэкспрессии обоих генов на другие, регулируемые RelA/p65, гены, а именно, TNC, BAX, FN1, FGF8, ICAM1, PTGS2 и MMP-3, относящиеся к различным путям сигнальной трансдукции. Анализ оверэкспрессии ACTN4 и RelA/p65 проводили на клетках линии НЕК293Т, через 67 ч после проведения трансфекции, методом ОТ-ПЦР.

Мы выявили, что уровень мРНК генов, регулируемых RelA/p65, ICAM1, TNC и, в меньшей степени MMP-3, FGF8 и FN1, возрастает при оверэкспрессии RelA/p65 (рис. 3, Б, Г), тогда как уровень экспрессии BAX и PTGS2, при тех же условиях, остается неизменным. Оверэкспрессия ACTN4 не приводила к значительным изменениям уровня экспрессии мРНК исследованных генов, тогда как совместная оверэкспрессия ACTN4 и RelA/p65 приводила к значительному увеличению уровня мРНК металлопротеиназы MMP3 (рис. 3, Б, нижняя панель). Исходя из того, что оверэкспрессия ACTN4 и RelA/p65 приводила к активации MMP-3, нами было сделано предположение о возможном изменении уровня экспрессии других типов металлопротеиназ, а именно, MMP-2, MMP-9 и MMP-1. Согласно результатам ОТ-ПЦР, уровень мРНК металлопротеиназ MMP-2 и MMP-9 не изменялся при оверэкспрессии ACTN4 и RelA/p65, тогда как для MMP-1 было отмечено увеличение уровня мРНК (рис. 3, Б, нижняя панель).

Подтверждение оверэкспрессии ACTN4 и RelA/p65 проводили, как и в случае люциферазного теста, методом иммуноблоттинга с антителами против маркерного пептида MYC, RelA/p65 и GAPDH, а также методом ОТ-ПЦР со специфическими парами праймеров к кДНК генов ACTN4, RelA/p65, 18S и GAPDH.

Таким образом, данные люциферазного теста и ОТ-ПЦР свидетельствуют о том, что ACTN4 потенциально может участвовать в регуляции не только RelA/p65-опосредованной экспрессии мышиного гена с-fos, но также и человеческих генов ММР-3 и ММР-1 (Aksenova et al., 2013).

Исходя из полученных данных, нами также была проанализирована регуляция экспрессии гена MMP-3 через 30, 48 и 67 ч после проведения трансфекции с плазмидами, кодирующими RelA/p65 и ACTN4. Было показано, что уровень мРНК увеличивается в зависимости от времени совместной оверэкспрессии ACTN4 и RelA/p65 (Аксенова и др., 2013). Так, при снятии клеток через 30, 48 и 67 ч после проведения трансфекции уровень мРНК, кодирующей ММР-3, возрастал (рис. 4).

Рис. 3. Оверэкспрессия ACTN4 усиливает транскрипционную активность NF-B. (А) Люциферазный тест на активность RelA/p65. Результаты представлены как отношение люминисценции к активности бета-галактозидазы в виде среднего значения трех и более повторностей одного эксперимента ±SD. *P 0.02 для оверэкспрессии ACTN4 и RelA/p65 против оверэкспрессии RelA/p65. (Б) ОТ-ПЦР NF-B регулируемых генов. (В) Иммуноблоттинг лизатов клеток, трансфицированных ACTN4 и RelA/p65. (Г) Данные количественной обработки результатов ОТ-ПЦР нетрансфицированных клеток НЕК293Т (линия 1) и клеток, трансфицированных по-отдельности ACTN4 (линия 2) и RelA/p65 (линия 3) и совместно (линия 4). Данные представлены как отношение уровня мРНК исследуемого гена к уровню мРНК гена GAPDH. Знаками +/- отмечено наличие/отсутствие оверэкспрессии.

Рис. 4. Экспрессия гена MMP-3 возрастает при совместной оверэкспрессии ACTN4 и RelA/p65.

ОТ-ПЦР анализ мРНК генов 18S, GAPDH, ACTN4, RelA/p65, MMP-3, через 30, 48 и 67 ч после проведения трансфекции. Знаками +/- отмечена оверэкспрессия ACTN4 и RelA/p65.

Эти данные также свидетельствуют в пользу того, что ACTN4 усиливает транскрипционную активность RelA/p при связывании с промотором гена MMP- и влияет на накопление мРНК гена MMP-3, а не на ее стабильность.

3.5 ACTN4 не влияет на перемещение RelA/p65 в ядро Ввиду того, что ACTN4 и RelA/p65 солокализуются в цитоплазме с F-актином, увеличение транскрипционной активности NF-B может быть опосредовано влиянием ACTN4 на транспорт RelA/p65 в ядро и, соответственно, на активацию белка. Чтобы проверить данное предположение, была проведена оверэкспрессия ACTN4 в клетках HEK293T, где RelA/p65 преимущественно находится в цитоплазме в комплексе с IB.

Методом иммунопреципитации удалось подтвердить, что экзогенный ACTN4Fl и RelA/p находятся в составе единых белковых комплексов в цитоплазме клеток HEK293T (рис. 5, А).

Далее мы провели трансфекцию клеток плазмидой, кодирующей ACTN4Fl и выполнили разделение фракций цитоплазма–ядро с последующим иммуноблоттингом со специфическими антителами против MYC, RelA/p65 и hnRNP A2/B1. Согласно полученным результатам, оверэкспрессия ACTN4 не влияла на перемещение RelA/p65 в ядро (рис. 5, Б). Таким образом, мы можем сделать вывод, что ACTN4 способствует усилению транскрипционной активности RelA/p65 в ядре, а не влияет на его комплексы с IB в цитоплазме (Aksenova et al., 2013).

Рис. 5. ACTN4 не влияет на активацию и перемещения RelA/p65 в ядро. (А) Иммунопреципитация RelA/p из цитоплазматических белковых лизатов клеток НЕК293Т с последующим иммуноблоттингом со специфическими антителами против RelA/p65 и MYC. Специфический сигнал наблюдали только в пробе с оверэкспрессированным ACTN4Fl при иммуноблоттинге с антителами против MYC и не наблюдали в контрольных клетках и лизатах без добавления специфических антител. (Б) Иммуноблоттинг цитоплазматических и ядерных лизатов со специфическими антителами против маркерного пептида MYC, RelA/p65 и hnRNPA2/B в контрольных клетках НЕК293Т и после трансфекции ACTN4Fl.

3.6 Димеризация ACTN4 и его связывание с F-актином не являются необходимыми для участия ACTN4 в регуляции работы RelA/p Основные функции ACTN4 в цитоплазме определяются его способностью связывать филаменты актина в единую фибриллярную сеть за счет формирования антипараллельных гомодимеров между двумя молекулами ACTN4. Тем не менее, на сегодняшний день остается открытым вопрос о взаимодействии ACTN4 с актином в ядре, а также о том, функционирует ли ACTN4 в ядре в виде димера или же нет.

Исходя из того, что ACTN4 способен усиливать транскрипционную активность RelA/p65, мы решили проверить, насколько необходимо для выполнения данной функций взаимодействие ACTN4 с актином и формирование димера между двумя молекулами Для решения ACTN4.

поставленной задачи была проведена оверэкспрессия делеционных вариантов ACTN4 в клетках линии НЕК293Т с последующим анализом экспрессии гена MMP-3.

На основе данных, полученных методом непрямой иммунофлуоресценции, были выбраны два варианта белка, ACTN4delN и Оба ACTN4delSR1-4.

описанных выше делеционных варианта способны перемещаться в ядро, но не содержат участков, ответственных за взаимодействие с F-актином (ACTN4delN), и не способны формировать димеры (ACTN4delSR1-4).

Рис. 6. Влияние делеционных вариантов ACTN4 на RelA/p65-опосредованную регуляцию экспрессии гена MMP-3. (А) ОТ-ПЦР анализ генов GAPDH, RelA/p65, ICAM1 и MMP-3 через 67 ч после проведения трансфекции плазмидами, кодирующими RelA/p65, ACTN4Fl, ACTN4delN, ACTN4delSR1-4. (Б) Данные количественной обработки результатов ОТ-ПЦР нетрансфицированных клеток НЕК293Т и клеток, трансфицированных RelA/p65 и RelA/p65 совместно c ACTN4Fl, ACTN4delN, ACTN4delSR1-4. Данные представлены как отношение мРНК исследуемого гена к мРНК гена GAPDH. Знаками +/- отмечено наличие/отсутствие оверэкспрессии. (В) Иммуноблоттинг клеточных лизатов НЕК293Т со специфическими антителами против маркерного пептида MYC и актина.

Способность данных делеционных вариантов участвовать в регуляции экспрессии гена MMP- сравнивали с активностью полноразмерного варианта белка. Клетки линии HEK293T были трансфицированы экспрессионными конструкциями, кодирующими собственно RelA/p65 или ACTN4Fl, ACTN4delSR1-4, ACTN4delN совместно с RelA/p65 субъединицей NF-B, с последующим анализом экспрессии методом ОТ-ПЦР генов GAPDH, RelA/p65, ICAM1 и MMP- (рис. 6, А, Б). Для подтверждения оверэкспрессии делеционных вариантов ACTN4 проводили иммуноблоттинг клеточных экстрактов после проведения трансфекции теми же экспрессионными плазмидами (рис. 6, В). Согласно полученным данным, делеционные варианты ACTN4delSR1-4 и ACTN4delN усиливали RelA/p65-зависимую экспрессию гена MMP-3, но в меньшей степени, чем полноразмерный ACTN4Fl (рис. 6, A, Б). Эти данные позволяют предположить, что ACTN4 в ядре сохраняет способность коктивировать RelA/p65 без образования димера и взаимодействие ACTN с актином также не является критичным для данной функции белка (Aksenova et al., 2013).

3.7 Участие ACTN4 в регуляции сплайсинга мРНК Ранее нами было показано, что ACTN4 в ядре ассоциирован с белками, функции которых связаны с метаболизмом мРНК (Хотин и др., 2009;

Khotin et al., 2010). Наиболее многочисленной группой белков, среди идентифицированных, были белки, относящиеся к семейству гетерогенных ядерных рибонуклеопротеинов (hnRNP A2/B1, A1, A3, K/J, L, M1-4). Поскольку участие гетерогенных ядерных рибонуклеопротеинов в процессе сплайсинга мРНК является одной из наиболее исследованных функций, то было принято решение проверить влияние ACTN4 на регуляцию процесса сплайсинга мРНК. В качестве модельных систем были выбраны ген пируваткиназы (РКМ) и ген выживания моторных нейронов (SMN), альтернативный сплайсинг которых контролируется hnRNP A1 и А2.

3.7.1 Исследование влияния ACTN4 на процесс альтернативного сплайсинга гена PKM1/PKM Альтернативный сплайсинг PKM играет важную роль в ходе изменений метаболизма клеток млекопитающих. Известно, что экспрессирующаяся в эмбриогенезе изоформа PKM – PKM2 синтезируется также в раковых клетках и обеспечивает процесс аэробного гликолиза.

Изоформа PKM1, экспрессируется в тканях взрослого организма и обеспечивает процесс окислительного фосфорилирования.

Обе изоформы являются продуктом одного гена и образуются в результате альтернативного сплайсинга, в результате которого мРНК PKM1 и PKM2 содержат два альтернативных экзона, 9-й экзон в случае PKM1 и 10-й экзон в случае в РКМ2 (рис. 7, А). Недавно было показано, что альтернативный сплайсинг данного гена контролируется белками hnRNP A1, hnRNP A2 и белком PTB (Polypyrimidine Tract Binding) путем непосредственного связывания с последовательностями, регулирующими включение экзона 10 (Сhen et al., 2010). hnRNP A2/B1 и A1 выступают в качестве супрессоров, подавляя включение 9-го интрона в PKM1. ACTN4 в составе данных комплексов потенциально может как подавлять активность hnRNP A2/B1 и A1 (быть супрессором), так и усиливать их активность (быть активатором). Соответственно, при супрессорной функции ACTN наблюдалось бы накопление изоформы PKM1, а при активирующей – полное переключение на синтез PKM2. Исследование влияния ACTN4 на процесс альтернативного сплайсинга мРНК PKM1/PKM2 проводили на нетрансфицированных клетках А431 и НЕК293Т, а также трансфицированных ACTN4Fl, методом ОТ-ПЦР с последующей обработкой ПЦР-продуктов ферментом Pst1. На рис. 7 (A и Г) приведена структура анализируемого участка гена и схема электрофореграмм.

Используя описанные выше методы, мы показали, что нетрансфецированные клетки культур НЕК293Т и А431 преимущественно экспрессируют пируваткиназу 2-го типа (75–87 %) и 13-25% пируваткиназы 1-го типа (рис. 7, В).

При оверэкспрессии ACTN4Fl, которая была подтверждена с использованием антител против ACTN (рис. 7, Б), было показано, что соотношение мРНК гена PKM1/PKM2 не отличается в контрольных клетках и клетках с оверэкспрессированным Эти данные позволяют ACTN4Fl.

предположить, что ACTN4, скорее всего, не влияет на процесс альтернативного сплайсинга гена PKM1/PKM2.

Рис. Влияние ACTN4 на процесс 7.

альтернативного сплайсинга гена PKM. (А) Схема структуры с 8-го по 11-й экзон гена PKM1/РКМ2.

Указано положение праймеров для проведения ПЦР-анализа стрелки) и (горизонтальные расположение сайта рестрикции для Pst (вертикальная стрелка). (Б) Оверэкспрессия ACTN4 в клетках линии НЕК293Т и А431. (В) Электрофореграмма продуктов ПЦР и рестрикции.

Для каждого типа клеток представлен ПЦР продукт (дорожка 1) и равный объем ПЦР продукта, обработанного рестриктазой Pst (дорожка 2). Контроль – нетрансфицированные клетки НЕК293Т и А431;

ACTN4Fl – клетки НЕК293Т и А431, трансфицированные полноразмерным ACTN4. (Г) Схема возможных вариантов элетрофореграммы, наблюдаемой после обработки ПЦР-продукта рестриктазой Pst1.

Исследование влияния 3.7. ACTN4 на процесс альтернативного сплайсинга генов SMN1/SMN В качестве другой модельной системы был выбран альтернативный сплайсинг генов SMN1/SMN2. Регуляция процесса альтернативного сплайсинга при образовании полноразмерного и укороченного вариантов мРНК, кодируемых генами SMN1 и SMN2, осуществляется при участии гетерогенных ядерных рибонуклеопротеинов, а именно hnRNP A1, hnRNP C1/C2 и hnRNP G и некоторых других белков. В норме, в результате процессов транскрипции и трансляции гена SMN1, образуется полноразмерный белок SMN, участвующий в биогенезе snRNP и обеспечивающий нормальное функционирование моторных нейронов (Jodelka et al., 2010). Ген SMN в геноме человека дуплицирован. С теломерной копии гена (SMN1) образуется полноразмерный белок, тогда как с центромерной (SMN2) – укороченный (рис. 8, А). Основное различие между генами SMN1 и SMN2 состоит в замене цитозина на тимин в 7-ом экзоне гена SMN2, которая приводит к вырезанию 7-го экзона и образованию укороченного варианта белка SMN (Simard et al., 2007). Предполагается, что hnRNP A1 играет ключевую роль в контроле сплайсинга 7-го экзона гена SMN2. Оценку влияния ACTN4 на соотношение мРНК, соответствующих полноразмерному и укороченному варианту мРНК гена SMN, проводили методом ОТ-ПЦР и последующей рестрикции ПЦР-продукта рестриктазой Dde I. Подтверждение оверэкспрессии ACTN4Fl проводили методом иммуноблоттинга с антителами против ACTN (рис. 8, Б).

ОТ-ПЦР анализ нетрансфицированных клеток НЕК293Т показал, что в этих клетках присутствует как полноразмерный вариант мРНК, который кодируется генами SMN1 и SMN2, так и укороченный вариант мРНК преимущественно образующийся в результате альтернативного сплайсинга гена SMN2 (рис. 8, В). Продукты альтернативного сплайсинга, образующиеся с генов SMN1 и SMN2, различаются по уникальному сайту рестрикции, который расположен в 8-ом экзоне гена SMN2.

Исследование влияния ACTN4 на сплайсинг генов SMN1/SMN2 проводили на контрольных клетках НЕК293Т и клетках НЕК293Т, трансфицированных ACTN4Fl. ОТ-ПЦР анализ генов SMN1 и SMN2 показал, что между контрольными клетками и клетками с оверэкспрессированным нет ACTN4Fl существенных различий в соотношении мРНК, соответствующих полноразмерному (505 п.н.) и укороченному (451 п.н.) варианту мРНК (рис. 8, В). Анализ длин рестрикционных фрагментов, который позволяет различить мРНК генов SMN и SMN2, также не показал разницы между контрольными клетками и клетками с оверэкспреcсированным ACTN4Fl (рис. 8, Г).

Рис. 8. Влияние ACTN4 на альтернативный сплайсинг генов SMN1/SMN2. (А) Схема и относительное расположение генов SMN1 и SMN2 на 5-ой хромосоме человека (рисунок из статьи Jodelka et al., 2010 с изменениями). (Б) Иммуноблоттинг клеточных экстрактов НЕК293Т с антителами против ACTN4. (В) ПЦР-анализ участка 6-8 экзонов генов SMN1 и SMN2 в клетках линии НЕК293Т. (Г) Продукты ферментативного гидролиза при обработке ОТ-ПЦР-продукта ферментом DdeI.

Таким образом, эти данные и данные по альтернативному сплайсингу, полученные для гена PKM, позволяют предположить, что входящий в состав белковых ACTN4, комплексов с hnRNP А1 и A2/B1, скорее всего не участвует в контроле сплайсинга рассмотренных генов, но, возможно, играет роль на других этапах метаболизма мРНК (Аксенова и др., 2013).

3.8 Эндогенный вариант ACTN4 с делецией кальпониновых доменов белка в нормальных и злокачественных клетках человека В клетках линии А431 в ходе клонирования полноразмерного варианта ACTN4 была выявлена его нативная изоформа, содержащая делецию кальпониновых доменов белка. Наличие данной изоформы белка в клетках линии А431 может значительно влиять на функции полноразмерного белка за счет образования гетеродимеров полноразмерного и укороченного вариантов белка, что, в свою очередь, может сказаться на способности ACTN4 взаимодействовать со структурами актинового цитоскелета. Исходя их данного предположения мы решили проверить наличие данной изоформы в других типах клеточных культур, помимо А431. На рис. 9 (А, Б, В) приведен скрининг белковых лизатов различных клеточных культур, таких как меланомы (SK MEL5, A375, A375P, WM2664, SK-MEL28, HS-695T);

клеточные культуры рака легкого (H522, A549, H520, H1299, H1650, H358, H23, H460);

клеточные культуры рака поджелудочной железы (BxPC-3, PANC-1, MIA PaCa-2, AsPC-1);

клеточные культуры рака молочной железы (MDA-MB 231, MCF-7, MDA-468);

клеточные культур рака мочевого пузыря (UMUC-3, J82). На рис.9 Г приведены результаты ОТ-ПЦР с кДНК нормальных кератиноцитов и фибробластов человека, а также клеток НЕК293Т.

Рис. 9. Иммуноблоттинг и ОТ-ПЦР анализ нормальных и раковых клеток человека. (А) иммуноблоттинг клеточных культур рака легкого с антителами против ACTN4;

(Б) иммуноблоттинг клеточных культур рака поджелудочной железы и рака молочной железы с антителами против ACTN4;

(В) иммуноблоттинг клеточных культур рака мочевого пузыря и меланом с антителами против ACTN4;

(Г) ОТ-ПЦР анализ кДНК нормальных кератиноцитов (КЦ), фибробластов (ФБ) и трансформированных эмбриональных клеток почки человека (НЕК293Т) с праймерами к полноразмерному ACTN4.

Согласно результатам исследования, данная изоформа белка была обнаружена только в клетках эпидермоидой карциномы А431 и не была обнаружена в других 23 раковых клеточных линиях и 2 нормальных первичных культурах клеток человека (фибробласты и кератиноциты), а также трансформированных клетках НЕК293Т. Данные результаты позволяют предположить, что описанная нами изоформа ACTN4 является специфичной для клеток линии А431 и не является маркерной для других проанализированных клеточных линий, а также не встречается в норме в нормальных кератиноцитах и фибробластах человека.

4. ВЫВОДЫ Транспорт ACTN4 в ядро и из ядра регулируется наличием в аминокислотной 1.

последовательности белка, c 1-го по 753-й остаток, двух или более последовательностей, необходимых для его транспорта в ядро. Как для ядерной локализации, так и для цитоплазматической локализации ACTN4 наличие одной функциональной последовательности является достаточным.

Делеции с 1-го по 295-й, с 48-го по 273-й и с 293-го по 753-й аминокислотный остаток приводят 2.

к полному нарушению взаимодействия ACTN4 со структурами актинового цитоскелета и к перемещению белка в ядро. Делеции с 753-го по 911-й и с 806-го по 911-й аминокислотный остаток влияют на взаимодействие ACTN4 с F-актином, но не существенны для импорта ACTN4 в ядро.

Внутриклеточное распределение вариантов ACTN4 при делеции с 1-го по 295-й, с 48-го по 273 3.

й и с 293-го по 753-й аминокислотный остаток белка изменяется при длительном культивировании и при кратковременном распластывании клеток.

Актин-связывающий белок ACTN4 принимает участие в регуляции экспрессии генов c-fos, 4.

MMP-3 и MMP-1 опосредованной RelA/p65 субъединицей NF-B, и не принимает участия в регуляции экспрессии генов ICAM1, FGF8, TNC, FN1, PTGS2, BAX.

ACTN4 принимает участие в регуляции активности RelA/p65 субъединицы транскрипционного 5.

фактора NF-B на уровне транскрипции, не влияя на ядерно-цитоплазматический транспорт RelA/p65. Димеризация и взаимодействие ACTN4 с актином в ядре не являются необходимыми для RelA/p65-опосредованной активации экспрессии гена MMP-3.

ACTN4 не является необходимым элементом комплексов, регулирующих сплайсинг генов PKM 6.

и SMN1/SMN2.

В клетках эпидермоидной карциномы А431 присутствует сплайсинговая изоформа ACTN4 с 7.

делецией кальпониновых доменов белка. Данная изоформа не выявляется в злокачественных клетках меланомы, рака мочевого пузыря, клетках рака легкого, поджелудочной железы и молочной железы, а также в нормальных фибробластах и кератиноцитах человека.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ Хотин М., Туроверова Л., Подольская Е., Краснов И., Соловьева А., Аксенова В., Магнуссон 1.

К.-Э., Пинаев Г., Тентлер Д. (2009) Исследование ядерных белковых комплексов альфа актинина-4 методами двумерного электрофореза и масс-спектрометрии. Цитология.T.51 (8):

684-690.

2. Aksenova V., Khotin M., Turoverova L., Pinaev G., Tentler D. (2009) Investigation of nuclear functions of actin-binding protein -actinin-4. VIIIth International Congress of Medical Science (ICMS) for students and young doctors. 7-10 May, Sophia, Bulgaria. C.56.

Аксенова В.Ю., Хотин М.Г., Туроверова Л.В., Пинаев Г.П., Тентлер Д.Г. (2009) Исследование 3.

ядерных функций актин-связывающего белка альфа-актинина 4 и его участия в регуляции экспрессии генов. V Съезд Вавиловского общества генетиков и селекционеров. 21-28 июня, Москва, Россия. Часть II, C.41.

Аксенова В., Хотин М., Туроверова Л., Пинаев Г., Тентлер Д. (2010) Изоформы актин 4.

связывающего белка альфа-актинина 4 (ACTN4) в клетках эпидермоидной карциномы человека (А431). II Молодежная конференция Института цитологии РАН. 15-16 февраля, Санкт Петербург, Россия. Т.52 (6): 493.

5. Aksenova V., Khotin M., Turoverova L., Pinaev G., Magnusson E.-E., Tentler D. (2010) Structure and functional specifity of alpha-actinin 4 (ACTN4) isoforms. Young Scientific Forum 23-26 June and FEBS Congress. 26 June – 01 July, Gothenburg, Sweden. FEBS Journal. T.277: 273.

6. Khotin M., Aksenova V., Turoverova L., Magnusson E.-E., Pinaev G., Tentler D. (2010) Alpha actinin 4 interacts with nuclear proteins, involved in mRNA splicing, transport and stability. Young Scientific Forum 23-26 June and FEBS Congress. 26 June – 01 July, Gothenburg, Sweden. FEBS Journal. T.277: 287.

7. Аксенова В., Хотин М., Туроверова Л., Пинаев Г., Тентлер Д. (2010) Выявление доменов актин-связывающего белка альфа-актинина 4 (ACTN4), ответственных за его локализацию и функционирование в ядре. XVI Симпозиум структура и функции клеточного ядра. 5-7 октября, Санкт-Петербург, Россия. Т.52 (8): 693-694.

8. Khotin M, Turoverova L, Aksenova V, Barlev N, Borutinskaite VV, Vener A, Bajenova O, Magnusson KE, Pinaev GP, Tentler D. (2010). Proteomic analysis of ACTN4-interacting proteins reveals it’s a putative involvement in mRNA metabolism. Biochem Biophys Res Commun 397 (2):

192-196.

9. Аксенова В., Хотин М., Туроверова Л.В., Юдинцева Н., Магнуссон К.-Э., Пинаев Г., Тентлер Д.

(2012). Новая сплайсинговая изоформа актин-связывающего белка альфа-актинина 4 в клетках эпидермоидой карциномы А431. Цитология 54 (1): 25-32.

10. Аксенова В.Ю., Хотин М.Г., Туроверова Л.В., Барлев Н.А., Пинаев Г.П., Тентлер Д.Г. (2013).

Участие альфа-актинина 4 в регуляции экспрессии генов и контроле сплайсинга мРНК.

Сборник трудов VI международной заочной научно-практической конференции. Научная дискуссия: вопросы физики, химии, биологии, Москва. С.91-101.

11. Aksenova V., Turoverova L., Khotin M., Magnusson K.-E., Tulchinsky E., Melino G., Pinaev G.P., Barlev N., Tentler D. (2013) Actin-binding protein alpha-actinin 4 (ACTN4) is a transcription co activator of RelA/p65 sub-unit of NF-B. Oncotarget 4 (2): 362-372.

СПИСОК ЦИТИРУЕМОЙ ЛИТЕРАТУРЫ Бабаков В.Н., Бобков Д.Е., Петухова О.А., Туроверова Л.В., Кропачева И.В., Подольская Е.П., Пинаев Г.П.

2004. Цитология. Т.46 (12): 1064-72. Блинова М.И., Юдинцева Н.М., Калмыкова Н.В., Кузьминых Е.В., Юрлова Н.А., Овчинникова О.А. 2002. Цитология. Т.44 (8): 780-787. Большакова А.В. 2009. Кандидатская диссертация: 1 130. Юдинцева Н.М., Блинова М.И., Пинаев Г.П. 2008. Цитология. Т.50 (10): 861-867. Babakov V.N., Petukhova O.A., Turoverova L.V., Kropacheva I.V., Tentler D.G., Bolshakova A.V., Podolskaya E.P., Magnusson K.-E., Pinaev G.P. 2008. Exper.Cell Res. V.314: 1030-1038. Barbolina M.V., Adley B.P., Kelly D.L., Fought A.J., Scholtens D.M., Shea L.D., Stack M.S. 2008. Laboratory Investigation. V.88: 602–614. Chen M., Zhang J., Manley J.L. 2010. Cancer Res. V.70:

8977-8980. Chakraborty S., Reineke E.L., Lam M., Li X., Liu Y., Gao C., Khurana S., Kao H.Y. 2006. J. Biol. Chem.

V.281: 35070-35080. Dreyfuss G., V. Kim N., Kataoka N. 2002. Mol. Cell Biol. V.3: 195-205. Gettemans J., Van Impe K., Delanote V., Hubert T., Vandekerckhove J., De Corte V. 2005. Traffic. V.6 (10): 847-57. Hara T., Honda K., Shitashige M., Ono M., Matsuyama H., Naito K., Hirohashi S., Yamada T. 2007. Mol. Cel. Prot. V.6: 479-491. Honda K., Yamada T., Endo R., Ino Y., Gotoh M., Tsuda H., Yamada Y., Chiba H., Hirohashi S. 1998. J. Cell Biol. V.140 (6): 1383-1393.

Honda K., Yamada T., Seike M., Hayashida Y., Idogawa M., Kondo T., Ino Y., Hirohashi S. 2004. Oncogene. V.23:

5257-5262. Jayadev R., Kuk C.Y., Low S.H., Hori M.M. 2012. Cell Cycle. V.11: 1929-1937. Jodelka F.M., Ebert A.D., Duelli D.M., Hastings M.L. 2010. Hum. Mol. Genetics. V.19 (24): 4906–4917. Koizumi T., Nakatsuji H., Fukawa T., Avirmed S., Fukumori T., Takahashi M., Kanayama H. 2010. Urology. V.75: 357–364. Kikuchi S., Honda K., Tsuda H., Hiraoka N., Imoto I., Kosuge T., Umaki T., Onozato K., Shitashige M., Yamaguchi U., Ono M., Tsuchida A., Aoki T., Inazawa J., Hirohashi S., Yamada T. 2008. Clin Cancer Res. V.14: 5348-5356. Khotin M., Turoverova L., Aksenova V., Barlev N., Veronika Borutinskaite V., Vener A., Bajenova O., Magnusson K-E., Pinaev G. P., Tentler D. 2010. V.397:

192-196. Khurana S., Chakraborty S., Cheng X., Su Y-T., Kao H-Y. 2011. J Biol. Chem. V.286 (3): 1850-9. Khurana S, Chakraborty S, Zhao X, Liu Y, Guan D, Lam M, Huang W, Yang S, Kao HY. 2012. J Biol. Chem. V.287 (42): 35418 29. Papakonstanti E.A., Stournaras C. 2008. FEBS Letters V.582: 2120–2127. Percipalle P. 2013. Nucleus 4 (1): 43–52.

Poch M. T., Al-Kassim L., Smolinski S.M., Hines R.N. 2004. Toxicol. App. Pharmacol. V.199: 239-250. Simard L.R., Be’langer M.-C., Morissette S., Wride M., Prior T.W., Swoboda K.J. 2007. Neurology. V.68: 451-456. Weins A., Kenlan P., Herbert S., Le T.C., Villegas I., Kaplan B.S., Appel G.B., Pollak M.R. 2005. J.Am.Soc.Nephrol. V.16: 3694-3701.



 

Похожие работы:





 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.