авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Особенности поведения drosophila melanogaster при различной структуре гена limk1

ИНСТИТУТ ФИЗИОЛОГИИ ИМ. И.П. ПАВЛОВА РАН

На правах рукописи

КАМИНСКАЯ АЛЕНА НИКОЛАЕВНА ОСОБЕННОСТИ ПОВЕДЕНИЯ DROSOPHILA MELANOGASTER ПРИ РАЗЛИЧНОЙ СТРУКТУРЕ ГЕНА limk1 03.03.01 – физиология 03.02.07 – генетика

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата биологических наук

Санкт-Петербург 2012

Работа выполнена в лаборатории нейрогенетики Института физиологии им. И.П.

Павлова РАН

Научный консультант: Савватеева-Попова Елена доктор биологических наук Владимировна Лопатина Нина Георгиевна

Официальные оппоненты:

Институт Физиологии им. И.П.

доктор биологических наук, Павлова РАН профессор Самбук Елена Викторовна доктор биологических наук Санкт-Петербургский Государственный Университет Институт Высшей Нервной

Ведущая организация:

Деятельности и Нейрофизиологии РАН, г. Москва

Защита состоится «20» февраля 2012 года в 11 часов на заседании диссертационного совета Д 002.020.01 при Учреждении Российской Академии Наук Института физиологии им. И.П. Павлова РАН по адресу: 199034, г. Санкт Петербург, наб. Макарова, 6.

С диссертацией можно ознакомиться в библиотеке

Автореферат разослан «_» января 2012 года

Ученый секретарь диссертационного совета доктор биологических наук Н.Э. Ордян

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Актуальной проблемой современной нейрофизиологии является изучение моторных и когнитивных функций с применением современных генетических методов, позволяющих изучать вклад отдельных генов, вовлеченных в реализацию данных функций. Полиморфизмы, а также точковые мутации таких генов опосредуют адаптацию к меняющимся условиям среды. Высокую степень пластичности нервной системы обеспечивает реорганизация актинового цитоскелета. Ключевым ферментом данного процесса является LIM-киназа (LIMK1) (Bamburg and Bloom, 2009). LIMK1 регулирует ремоделирование актина за счет фосфорилирования кофилина и перевода его в неактивную форму (Yang et al., 2000), что вызывает перестройку шипиков дендритов и модификацию аксонов, обеспечивая этим синаптическую пластичность. Кроме этого, LIMK фосфорилирует транскрипционный фактор CREB, тем самым, стимулируя активацию CREB-зависимых сигнальных путей. Экспрессия гена limk регистрируется преимущественно в нервных тканях (Mori et al., 1997). Делеция гена, кодирующего LIMK1 у мыши приводит к аномалиям в структуре синапса и формирования шипиков дендритов (Meng et al., 2002). Делеция 7q11.23, затрагивающая ген limk1 у человека, приводит к развитию синдрома Уильямса, сопровождаемого когнитивными нарушениями и моторными дисфункциями.

Нейродегенеративные болезни, такие как болезнь Альцгеймера, Хангтингтона и Паркинсона, также относят к болезням цитоскелета – кофилинопатиям. Это утверждение основано на том, что образование кофилин-актиновых комплексов в нейронах нарушает везикулярный транспорт и регистрируется на ранних стадиях деменции (Bamburg and Zheng, 2010). Среди диагностических признаков этих болезней выделяют три основных: 1) нарушение памяти, 2) моторную дисфункцию и 3) образование белковых агрегатов. Исследование механизмов нейродегенеративных заболеваний требует создания адекватной животной модели для разработки тест-систем и скрининга лекарственных средств с учетом диагностических признаков. Одним из наиболее удобных модельных объектов является Drosophila melanogaster (Moloney et al., 2010). Нервные сети насекомых устроены существенно проще, чем у млекопитающих, но обладают сходными функциональными возможностями. Их работа основана на использовании общих молекулярных компонентов, кодируемых гомологичными генами – параллелизм функций по М.Е. Лобашеву и Л.А. Орбели (Лобашев, 1951, 1960).

Биоинформационный анализ нуклеотидной последовательности гена limk1 D.

melanogaster выявляет высокую степень идентичности (71%) гомологичному гену H. sapiens (National Centre for Biotechnology Information). Ген limk1 дрозофилы расположен в районе 11АB Х-хромосомы в локусе agnostic, обрамленном А/Т богатыми областями, насыщенными палиндромными последовательностями и короткими нуклеотидными повторами. Эти структурные особенности предрасполагают к встройке мобильных элементов и возникновению спонтанных мутаций в разных природных популяциях (Edelmann et al., 2001). Наличие природных полиморфных вариантов в гене limk1 позволяет использовать их как инструмент при изучении нейродегенеративных заболеваний, которые в большинстве случаев возникают спонтанно под действием неблагоприятных факторов окружающей среды. Наличие у D. melanogaster такой формы поведения, как ритуал ухаживания, который состоит из ряда последовательных стадий, включая генерацию самцом звуковых сигналов (Manning, 1967), позволил разработать метод условно-рефлекторного подавления ухаживания, оценивающий как способность к обучению и формированию памяти, так и к локомоции.

Генерация самцом звуковых сигналов ухаживания обеспечивается функционированием II дорзального нерва, иннервирующего мышцы крыла.

Регистрация этих сигналов аналогична записи электромиограмм у человека, позволяющая выявлять локомоторные нарушения, как ранний признак нейродегенеративных заболеваний. Наличие амилоидных включений в области нейромышечных контактов, образованных актин-кофилиновыми комплексами затрудняет проведение сигнала и, как следствие, нарушает синхронизацию мышечных волокон. Однако при изучении роли LIMK1 в реализации моторных функций, обучении и памяти не учитывается то, что фермент LIMK1 представлен несколькими изоформами с различной протеинкиназной активностью. Поскольку вклад изоформ LIMK1 в нормальное функционирование нейрональных ансамблей и нейромышечных контактов мало изучен, мы использовали лабораторные линии дикого типа с полиморфизмами в гене limk1 и индуцированную мутацию по локусу agnostic.



Цель диссертационной работы состояла в изучении звукопродукции, обучения и памяти в сопоставлении со структурой гена limk1 и характером его экспрессии в разных линиях Drosophila melanogaster.

Задачи исследования:

1. Провести количественный анализ содержания LIMK1 в мозге самцов D.

melanogaster линий Canton-S, Berlin, Oregon-R и agnts3;

2. Провести анализ нуклеотидной последовательности 5’-некодирующей и структурной областей гена limk1 D. melanogaster в сопоставлении с характером экспрессии на уровне транскрипции гена limk1 линий Canton-S, Berlin, Oregon-R и agnts3;

3. Охарактеризовать распределение амилоидных включений, p-кофилина и pCREB в аксонах II дорзального нерва у самцов линий Canton-S, Berlin, Oregon-R и agnts3 до и после 5 часового обучения;

4. С использованием установки для регистрации звуковых сигналов ухаживания охарактеризовать основные параметры звуковых коммуникационных сигналов и поведения ухаживания, а также оценить способность к обучению у самцов линий Canton-S, Berlin, Oregon-R и agnts3 при различной длительности тренировки.

Научная новизна. Впервые была выявлено различное соотношение D- и C изоформ LIMK1 у линий дикого типа D. melanogaster Canton-S, Berlin и Oregon-R при сопоставимом суммарном содержании LIMK1;

для мутантной линии agnts3 при неизменном соотношении D- и С-изоформ LIMK1 показано более высокое содержание обеих изоформ по сравнению с Сanton-S. Впервые в 5’-регуляторной и структурной областях гена limk1 дрозофилы выявлены однонуклеотидные полиморфизмы у Canton-S, Berlin, которые у Oregon-R и agnts3 закреплены в форме однонуклеотидных замен. Эти мутационные изменения оказывают влияние: 1) на уровни мРНК LIMK1 у Berlin, Oregon и agnts3 снижены относительно Сanton-S;

2) на локализацию фосфорилированной формы CREB и наличие амилоидных включений в области нейромышечных контактов II-дорзального нерва у самцов мутантной линии agnts3;

3) на особенности поведения ухаживания и звукопродукции при ухаживании самцов линий Berlin, Oregon-R и agnts3 4) на формирование памяти у самцов Berlin, Oregon-R и agnts3 дрозофилы на основании парадигмы условнорефлекторного подавления ухаживания при регистрации звуковых сигналов ухаживания. Также впервые была показана вненейрональная локализация p-кофилина в области нейромышечных контактов контактов II дорзального нерва у имаго самцов дрозофилы.

Теоретическая и практическая значимость. Полученные в работе результаты расширяют теоретическое представление о молекулярных механизмах участия компонентов сигнального каскада ремоделирования актина (LIMK1, кофилина и CREB) в реализации врожденных и приобретенных форм поведения.

Практическая ценность работы заключается в разработке метода оценки способности к обучению при регистрации звуковых коммуникационных сигналов ухаживания имаго самцов дрозофилы, характеризующихся наличием полиморфизмов или мутаций в генах, обеспечивающих нейрональную пластичность. Разработанные методы можно использовать для поиска лекарственных препаратов, корректирующих данные нарушения. Препараты, прошедшие отбор на такой системе, можно переводить на следующий этап тестирования с использованием позвоночных животных.

Основные положения, выносимые на защиту.

1. Различное содержание изоформ фермента LIMK1, вызванное изменением структуры гена limk1 (полиморфизмы и точковые мутации) принимает участие в формировании памяти D. melanogaster.

2. Полиморфизмы и мутации в гене limk1 у самцов agnts3 вызывают проявление основных диагностических признаков нейродегенеративных болезней:

нарушение памяти, моторную дисфункцию и образование белковых агрегатов.

Личный вклад. Основная часть представленных в диссертации результатов получена лично автором. Получение нейромышечных препаратов мезоторокального сегмента имаго Drosophila проводилось совместно с канд. биол.

наук А.В. Медведевой. Секвенирование нуклеотидной последовательности гена limk1, объяснение и интерпретация результатов были осуществлены совместно с научным руководителем и другими соавторами научных работ, опубликованных соискателем.

Апробация результатов и публикации. Представленные результаты неоднократно докладывались на различных научных конференциях и школах и отражены в тезисах докладов: Международной школе-конференции «Системный контроль генетических и цитогенетических процессов» (Санкт-Петербург, 2007), Научное наследие академика Л.А. Орбели. Структурные и функциональные основы эволюции функций, физиология экстремальных состояний (Санкт-Петербург, 2008), Международной конференции студентов, аспирантов и молодых ученых «Ломоносов-2009» (Москва, 2009), Съезде генетиков и селекционеров, посвященный 200-летию со дня рождения Ч. Дарвина и Пятом съезде Вавиловского общества генетиков и селекционеров (Москва, 2009), IX Conference of International Society of Invertebrate Neurobiology (ISIN) “Simpler Nervous Systems” (Saint-Petersburg, 2009), VI International interdisciplinary congress «Neuroscience for medicine and psychology» (Sudak, Ukraine, 2010), 7th Forum of European Neuroscience (Netherlands, July 2010);





IV Международной школе молодых ученых по молекулярной генетике «Геномика и биология клетки» (Звенигород, 2010), Конференции молодых ученых «Механизмы адаптации физиологических систем организма к факторам среды, посвященная 85-летию со дня основания Института физиологии им. И.П. Павлова РАН (Санкт-Петербург, 2010), 10th International Conference on Alzheimer's & Parkinson's disease (Spain, 2011), 23rd Biennial Meeting ISN-ESN-2011 (Greece, 2011), III съезде физиологов СНГ (Украина, Ялта, 2011), Международной молодежной конференции «Популяционная генетика:

современное состояние и перспективы» (Москва, 2011), Всероссийской молодежной конференции-школе «Нейробиология интегративных функций мозга» (Санкт-Петербург, 2011).

Публикации по теме диссертации. Основное содержание диссертации отражено в 23 публикациях, из них 2 научные статьи в рецензируемых журналах, включенных в Перечень ВАК РФ.

Структура и объем диссертации. Диссертация состоит из введения, обзора литературы, описания материалов и методов исследования, результатов исследований, обсуждения, выводов и списка цитируемой литературы. Работа изложена на 162 страницах печатного текста, содержит 30 рисунков и 11 таблиц.

Список литературы включает 275 источников.

МАТЕРИАЛЫ И МЕТОДЫ Линии D. melanogaster. Использовали мух линий Canton-S, Berlin, Oregon-R и agnts3, проявляющие полиморфизм по гену limk1: 1) Berlin – выделена из дикой популяции города Берлина и широко используется в поведенческих исследованиях в Европе;

2) Oregon-R - линия из дикой популяции штата Орегон, США. На генетическом фоне этой линии дикого типа существуют многие известные линии маркеры и балансеры;

3) линия agnts3 несет температуро-чувствительную (ts) мутацию, полученную и поддерживаемую на генетическом фоне линии Canton-S.

Canton-S использовали в качестве контрольной линии дикого типа. Мух выращивали на стандартной среде для дрозофил (агар, изюм, дрожжи, сахар) в условиях постоянного цикла день/ночь (12 ч./12ч.) при 25±0.5 °С. Исследования проводили на взрослых мухах в возрасте 5 дней, при температуре +25±0,5оС, в первой половине дня.

1. Молекулярно-генетические методы. Выделение ДНК из голов D.

melanogaster проводили по стандартной методике (http://molbiol.ru/protocol/14_04.html). Электрофорез в полиакриламидном геле и вестерн-блот проводили по стандартной методике (http://molbiol.ru/protocol/17_01.html). Выделение РНК из голов D. melanogaster проводили с использованием TRI-реагента согласно инструкции производителя (Sigma, США). Обратную транскрипцию проводили с использование случайных наномеров (Sigma,США) и обратной транскриптазы M-MLV RT (Promega, США) согласно рекомендациям производителей. ПЦР, ПЦР в режиме реального времени и определение нуклеотидной последовательности ДНК (сиквенирование) проводили с использованием приборов и реактивов фирмы Applied Biosystems, США в соответствии с рекомендациями производителя. Биоинформационный анализ по поиску микро РНК и генов-мишеней проводили с использованием ресурсных баз данных – www.miRbase.org и http://www.targetscan.org/fly/.

Приготовление препаратов 2. Иммуногистохимические методы.

нейромышечных контактов имаго дрозофилы осуществляли согласно стандартной методике (Rivlin et al., 2006). При имимуногистохимическом окрашивании использовали антитела к HRP (1:200, Jackson ImmunoResearch Laboratories, США), к p-кофилину (1:100, SantaCruz, США) и к р-CREB (1:100, Abcam, США), а также флуоресцентный краситель Тиофлавин S (0,01%, Sigma, США). Получение препаратов и анализ изображений проводили c помощью конфокального микроскопа Leica TCS SP5 MP (Leica Microsystems GmbH Wetzlar, Германия) и программного обеспечения Fiji.

3. Анализ поведения Drosophila melanogaster. В качестве объектов ухаживания для самцов использовали виргинных или оплодотворенных за сутки до опыта самок линии Canton-S. В каждой линии тестировали не менее 20 пар мух. При регистрации параметров ухаживания самца за виргинной самкой продолжительность наблюдения составляла 10 мин. Фиксировали латентный период до ухаживания (ЛПУ), длительность ухаживания (ДУ) и время начала копуляции. Длительность ухаживания рассчитывали как разность времени копуляции и начала ухаживания. Эффективность ухаживания (ЭУ) вычисляли как процент пар копулировавших в течение периода наблюдения.

Регистрацию и анализ звуковых сигналов проводили с помощью аналого цифрового преобразователя и записи звуковых файлов с использованием программы Н.Г. Камышева (Попов и др. 2000, 2006).

Оценку способности к обучению проводили, на основе условно-рефлекторного подавления ухаживания (Kamyshev et al., 1999) с использованием установки, регистририрующей импульсную и синусоидальную песни ухаживания.

Успешность обучения тестировали при разной длительности тренировки: после мин и после 5 часов тренировки для определения формирования среднесрочной памяти и долгосрочной памяти соответственно. Сохранность среднесрочной памяти тестировали через 3 часа после 30 мин тренировки. В качестве контроля использовали самцов, не имеющих опыта полового поведения.

4. Статистическая обработка полученных результатов проводили с помощью программного обеспечения Statistica 6.0. Использовали тест Манн-Уитни для длительности импульсных посылок;

критерий Фишера для эффективности ухаживания;

тест Левина для дисперсии МИИ;

рандомизационный анализ для соотношения индексов импульсной и синусоидальной песен, а также для оценки способности к обучению и исследования звукопродукции самца при ухаживании.

Дисперсионный анализ использовали при оценке значений интенсивности окрашивания белковых полос LIMK1. При анализе распределения Тиофлавина S, p- кофилина и pCREB использовали t критерий для долей. В остальных случаях применяли непарный t-критерий Стьюдента.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ 1. Определение количества LIMK1 в мозге самцов линий Canton-S, Berlin, Oregon-R и agnts3 D. melanogaster С использованием метода иммуноблоттинга и последующей гибридизацией антител к С-концу LIMK1 был проведен количественный анализ содержания и соотношения D- и C-изоформ LIMK1 в мозге самцов линий Canton-S, Berlin, Oregon-R и agnts3 (Рис. 1 а), не менее чем в 3-х повторностях. Соотношение между изоформами D и C LIMK1 и их количество в мозге самцов между анализируемыми линиями варьировало. Так, количество D- и C-изоформ LIMK1 у аgnts3 в 3 раза превышало таковое у Canton-S (Рис. 1 б), в то время как их соотношение у аgnts3 не отличалось от такового у Canton-S (Рис. 1 в). Количество D-изоформы у Berlin в раза превышало таковое у Canton-S, а у Oregon-R было в 2 раза меньше, чем у Canton-S (Рис. 1 б). Для линий дикого типа характерно различное соотношение D и C-изоформ (Рис. 1 в). Однако суммарное количество обеих изоформ LIMK1 у Berlin и Oregon-R было сопоставимым с таковым у Canton-S.

Рис. 1. Вестерн-блот анализ LIMK1 у самцов линий Canton-S, Berlin, Oregon-R и agnts3 а) С- и D-изоформы LIMK1;

б) содержание D- и C-изоформ;

в) соотношение количества изоформ D/C;

* - отличие от Canton-S, (двусторонний тест рандомизации, p0.05).

Таким образом, впервые было выявлено различное содержание и соотношение изоформ LIMK1 у линий дикого типа Berlin, Oregon-R и Canton-S и мутантной линии agnts3, что, возможно, регулируется различными механизмами.

2. Характеристика 5’-регуляторной и структурной областей гена limk линий Canton-S, Berlin, Oregon-R и agnts3 D. melanogaster Для выяснения причин возникновения обнаруженных различий в содержании и соотношении изоформ LIMK1 у линий дикого типа Berlin, Oregon-R и Canton-S и мутантной линии agnts3 была проанализирована последовательность нуклеотидов гена limk1. Сравнение проводили относительно консенсусной нуклеотидной последовательности, взятой из базы данных Flybase (flybase.com).

Был выявлен ряд изменений в 5’–нетранслируемом районе (5’–UTR) и области инициации транскрипции LIMK1 (Рис. 2).

У линий дикого типа Canton-S и Berlin в 5’–UTR гена limk1 обнаружены однонуклеотидные полиморфизмы (single nucleotide polymorphism, SNP) A/T и G/T в позициях -68 и -64 от старта транскрипции соответственно. У agnts3 в 5’–UTR были зарегистрированы: однонуклеотидные замены СТ в позиции -197 от старта транскрипции, АТ в позиции -68 от старта транскрипции и GТ в позиции - от старта транскрипции.

Далее мы обратились к поиску нуклеотидных последовательностей, расположенных за началом точки инициации транскрипции. У Canton-S и Berlin обнаружено наличие SNP в позиции +12 от старта транскрипции – С/Т. Кроме того, у Canton-S SNP – С/Т был также локализован в позиции +112 от старта транскрипции. У agnts3 были зарегистрированы замены СТ в позициях +12 и +112 от старта транскрипции.

Рис. 2. Особенности 5’-регуляторной области и области инициации транскрипции гена limk1 у линий Canton-S, Berlin и agnts3 D. melanogater;

SNP – single nucleotide polymorphism, однонуклеотидный полиморфизм.

Проанализирована структурная часть отдельных районов гена limk1, включающая LIM, PDZ и протеинкиназный домены. У линии Canton-S в области интрона 1 выявлено SNP C/T. У линии Berlin также локализованы SNPs – 2 G/A и G/C (Рис. 3). У линий Oregon-R и agnts3 зарегистрированы однонуклеотидные замены CA, СТ, 2 AG, AТ, GА, однонуклеотидная инсерция А, 28 нуклеотидная инсерция в позиции, а также делеции длиной 9 нуклеотидов и в нуклеотид Т (Рис. 3).

Рис. 3. Особенности области интрона 1 гена limk1 у линий Canton-S, Berlin, Oregon-R и agnts3 D. melanogaster * - инсерция AATTCGATTCTTTATTATTTATTATTAT ** - делеция AACACTTAA SNP – single nucleotide polymorphism, однонуклеотидный полиморфизм В области гена limk1, кодирующего LIM1 домен, у линии Canton-S присутствует SNP С/T, в этой же позиции у agnts3 – замена СТ (Рис. 4). В LIM домене у линии agnts3 обнаружена замена GA. В PDZ домене выявлены: у линии Canton-S – SNP Т/С и А/Т, в этих же позициях у agnts3 – однонуклеотидные замены TC и AT, у линии Oregon-R – однонуклеотидная замена AТ. В области протеинкиназного домена отмечены: у Canton-S SNPs 2 С/Т, G/A, A/G и 3 Т/С, у Oregon-R в этих же позициях гена – однонуклеотидные замены 3 СT, 2 GA, TC, АG, а также СG и AT.

Рис. 4. Особенности областей гена limk1, кодирующих LIM, PDZ и киназный домены LIMK1 у линий Canton-S, Berlin, Oregon-R и agnts3 D. melanogaster, SNP – single nucleotide polymorphism, однонуклеотидный полиморфизм.

Множественные замены у Oregon-R в участке гена, кодирующего протеинкиназный домен, не затрагивают кодоны, которые соответствуют аминокислотам, входящим в состав петли активации с Arg495 по Arg506, а также аминокислоте активного центра Thr 508, необходимой для активации LIMK1.

SNPs в смысловых участках гена могут изменять первичную, а в дальнейшем и третичную структуру белка, что модифицируют стабильность связывания с субстратом. При этом функциональные характеристики белков могут сильно меняться от практически нейтрального эффекта генетического полиморфизма до полной потери функции соответствующего белкового продукта.

Некодирующие районы ДНК обладают важными регуляторными функциями, и мутации в них элиминируются естественным отбором.

Биоинформационный анализ А.В. Журавлева показывает, что в норме в области интрона 1 гена limk1 образуются шпилечные структуры. Локализованная нами 28 нуклеотидная инсерция и 9-нуклеотидная делеция в этой области у линий Oregon-R и agnts3 предрасполагают к образованию высоко стабильных шпилечных структур с большей вероятностью по сравнению с образованием таковых структур в консенсусной последовательности (неопубликованные данные).

Согласно данным биоинформационного анализа 28-нуклеотидная инсерция в области интрона 1 гена limk1 у линий Oregon-R и agnts3 приводит к формированию шпильки в мРНК, которая, возможно, вырезается с образованием микро РНК частично гомологичной dme-mir-1006 (miRbase.org). dme-mir-1006 репрессирует трансляцию генов, вовлеченных в регуляцию звукопродукции и формирования памяти. Дисрегуляцию функционирования различных микро РНК выявляют при спорадических нейродегенеративных заболеваниях (Hebert et al., 2008).

Полученные нами данные на основании биоинформационного анализа требует дальнейшего экспериментального подтверждения.

Формирование шпилечных структур внутри и за пределами гена может оказывать многокомпонентное влияние на регуляцию его экспрессии. В частности, изменения конформацию ДНК промоторной области, влияют на характер связывания транскрипционных факторов с этой областью. В гене limk расположены 3 промотора для инициации транскрипции различных изоформ мРНК. Наличие шпилек, по-видимому, изменяет конформацию хроматина в районе локализации промоторов, что приводит к смещению равновесия в сторону образования более короткого транскрипта, т.е. D-изоформы и снижению содержания С-изоформы LIMK1 у Oregon-R. В то же время наличие аналогичной инсерции и делеции у agnts3 сопровождается повышением содержания как изоформы С, так и D LIMK1. Это, по-видимому, вызвано в большей мере наличием инсерции в 3’–UTR, зарегистрированной нами ранее (Медведева и др., 2008).

3. Анализ экспрессии гена limk1 у линий Canton-S, Berlin, Oregon-R и agnts3 D.

melanogaster на уровне транскрипции С целью изучения различного содержания и соотношения изоформ LIMK1 и учетом особенностей последовательности нуклеотидов гена limk1 у линий Canton S, Berlin, Oregon-R и agnts3 проведен сравнительный анализ уровней мРНК LIMK1 в 4 повторностях. Показано достоверное снижение уровня мРНК limk1 у Berlin, Oregon-R и agnts3 по сравнению с таковым у Canton-S (Рис. 5). Уровни мРНК limk между линиями Berlin, Oregon-R и agnts3 достоверно не отличались.

Рис. 5. Уровень экспрессии мРНК гена limk1 у самцов линий Canton-S, Berlin, Oregon-R и agnts3 D. melanogaster;

* - отличие от Canton-S, (двусторонний тест рандомизации, p0,05).

Таким образом, различное содержание и соотношение изоформ LIMK1, по всей видимости, вызвано снижением количества синтезируемой мРНК LIMK1 у Berlin, Oregon-R и agnts3 из-за изменения отдельных этапов процессинга РНК.

Возможно, это вызывает изменения сплайсинга, транспорта мРНК из ядра и эффективности инициации трансляции. Кроме того, возможно, эффективность связывания и функционирования молекул-активаторов необходимых для эффективной транскрипции гена limk1 снижена у Berlin, Oregon-R и agnts3.

Подтверждение данной гипотезы требует дополнительных исследований.

4. Распределение белковых агрегатов в области нейромышечных контактов II дорзального нерва мезоторакального сегмента имаго самцов линий Canton-S, Berlin, Oregon-R и agnts3 D. melanogaster Наличие однонуклеотидных замен в LIM и PDZ доменах LIMK1 у самцов agnts3, линии возможно, изменяет белок-белковые взаимодействия, осуществляемые этими доменами, и приводит к образованию белковых агрегатов.

Поэтому нами проведен анализ их распределения в области нейромышечных контактов мезоторакального сегмента имаго Canton-S, Berlin, Oregon-R и agnts3 с использованием флуоресцентного красителя Тиофлавина S и с последующей визуализацией с помощью конфокального микроскопа. У линий Canton-S, Oregon и Berlin амилоидные включения встречаются в терминалях аксонов 1-го типа в области нейромышечных контактов мезоторакального сегмента. Амилоидные включения у agnts3 выявлены с большей частотой по сравнению с Canton-S и преимущественно расположены в зоне тонких отростков аксонов 2-го типа образующих поперечные перемычки.

5. Распределение p-кофилина и pCREB в области нейромышечных контактов II дорзального нерва мезоторакального сегмента имаго D.

melanogaster Методом иммуногистохимической детекции антител к р-кофилину и к pCREB с последующей визуализацией с помощью конфокального микроскопа проанализировано распределение pCREB и р-кофилина в области нервно мышечных контактов мезоторакального сегмента Canton-S, Berlin, Oregon-R и agnts3 дрозофилы до и после обучения. Характер распределения p-кофилина в области мезоторакального сегмента самцов имаго дрозофилы не различается между линиями Canton-S, Berlin, Oregon-R и agnts3 как до, так и после обучения. Р кофилин в основном экспрессируется в глиальной оболочке, формируемой Шванновскими клетками.

Характер распределения pCREB в области мезоторакального сегмента самцов имаго дрозофилы различался между линиями Canton-S, Berlin, Oregon-R и agnts3. Так, у Canton-S до обучения pCREB выявлен в области тонких отростков аксонов преимущественно в области поперечных перемычек между аксонами (Рис.

6 а), а после обучения – в зоне продольных отростков аксонов (Рис. 6 б). У agnts характер распределения pCREB отличался от Canton-S. До обучения pCREB у agnts3 аккумулировался в зоне продольных отростков аксонов и в поперечных перемычках между аксонами (Рис. 6 в), после обучения – в поперечных перемычках между аксонами подобно распределению pCREB у Canton-S до обучения (Рис. 6 г).

Рис. 6.

Распределение pCREB в области нейромышечных контактов мезоторакально го сегмента: а, в – в контрольной группе;

б, г – после обучения имаго самцов D.

melanogaster линий Canton-S и agnts соответственно.

HRP-красный, pCREB-зеленый.

Калибровочный маркер 50 мкм.

6. Характеристика поведения ухаживания самцов D. melanogaster Сравнительный анализ по трем параметрам поведения ухаживания выявил следующие особенности анализируемых линий (Таб. 1). ЛПУ Oregon-R и agnts достоверно превышал таковой у Canton-S в 2 раза, что не оказало влияния на эффективность ухаживания, которая у линий agnts3 и Oregon-R была сопоставима с таковой у Canton-S. В то же время увеличение ЛПУ у Berlin в 4 раза по сравнению с Canton-S сопровождается достоверным снижением эффективности ухаживания.

ДУ Berlin и Oregon-R достоверно превышала таковую у Canton-S, в то время как для agnts3 статистически значимых различий выявлено не было.

Таблица 1 Параметры ухаживания самцов линии Canton-S, Berlin и Oregon-R и agnts линия n ЛПУ, с ДУ, с ЭУ, % Canton-S 63 22±3 145±17 Berlin 66 80±12* 324±28* 50* Oregon-R 61 54±9* 264±21* agnts3 51 55±9* 162±19 n – число тестированных самцов;

ЛПУ – латентный период ухаживания;

ДУ – длительность ухаживания;

ЭУ – эффективность ухаживания;

*- отличие от Canton-S (непарный t-критерий Стьюдента, для ЭУ - сравнение долей по Фишеру, p0,05).

7. Характеристика звуковых сигналов ухаживания самцов D. melanogaster С использованием установки автоматической регистрации звукопродукции самцов дрозофилы был проведен сравнительный анализ звуковых сигналов ухаживания самцов agnts3, Berlin и Oregon-R в сопоставлении с Canton-S. Из оцененных параметров, на рисунке 7 приведены 4. Индекс пения у agnts3 и Oregon R не отличаются от таковых у Canton-S. Для Berlin характерно трехкратное снижение этого параметра (Рис. 7 а). Межимпульсный интервал у самцов agnts короче, чем у Canton-S, что свидетельствует о более высоком ритме пения agnts3.

Для Berlin и Oregon-R, напротив, характерно увеличение этого параметра (Рис. 7 б).

Основная частота синусоидальной песни анализируемых линий также отличается от таковой у Canton-S. Так, для agnts3 и Oregon-R характерно увеличение значения этого параметра, в то время как для самцов Berlin снижение относительно Canton-S (Рис. 7 в). Процент искаженных импульсов характеризует частоту нарушений режима работы крыловых мышц. agnts3 по этому параметру не отличается от Canton-S. Berlin и Oregon-R демонстрируют более высокие уровни искаженных импульсов (Рис. 7 г). Искажения с увеличенной длительностью импульса наиболее часто встречаются у Вerlin и Oregon-R, в то время как у agnts3 они возникают реже.

У agnts3 наиболее часто возникают искажения с полициклическими импульсами, вызванные, по-видимому, тремором мышц пения.

Рис. 7. Параметры звуковых сигналов самцов линий Canton-S, Berlin, Oregon-R и agnts3:

а) индекс пения;

б) межимпульсный интервал;

в) основная частота синусоидальной песни;

г) процент искаженных импульсов;

* - отличие от Canton-S (непарный t критерий Стьюдента, p0,05).

Таким образом, повышение содержания изоформ LIMK1 у agnts сопровождается образованием белковых агрегатов и усилением частоты импульсов при звукопродукции.

8. Оценка способности к обучению самцов D. melanogaster при различной продолжительности тренировки Сравнительный анализ условно-рефлекторного подавления ухаживания при различной длительности тренировки — 30 мин и 5 ч – между линиями Canton-S, Berlin, Oregon-R и agnts3 показал, что анализируемые линии характеризуются различной способностью к обучению при двух режимах тренировки (Рис. 8).

Рис. 8. Влияние продолжительности тренировки самцов линий Canton-S, Berlin, Oregon-R и agnts3 на выработку условно-рефлекторного подавления ухаживания;

30 – индекс обучения после окончания 30 мин тренировки (среднесрочная память);

5 ч - индекс обучения после окончания 5 ч тренировки (долгосрочная память).

Р –отличие от нуля, (односторонний тест рандомизации, p0,05);

* - отличие от Canton-S, (двусторонний тест рандомизации, p0,05);

# - отличие от 30 мин обучения, (двусторонний тест рандомизации, p0,05).

Так, у линии Canton-S условно-рефлекторное подавление ухаживания наблюдалось как после 30 мин, так и после 5 ч тренировки (индексы обучения были достоверно выше нуля). У самцов линий Berlin и Oregon-R, в отличие от индекса обучения после 30 мин тренировки, после 5 ч тренировки условно рефлекторное подавление ухаживания регистрировалось, индексы обучения были достоверно выше нуля и не отличались от таковых у Canton-S. У линии Oregon-R индекс обучения после 5 ч тренировки достоверно отличался от такового после мин тренировки. У самцов линии agnts3 после 5 ч тренировки, также как и после мин тренировки, условно-рефлекторного подавления ухаживания не наблюдалось, индекс обучения не отличался от нуля и достоверно отличался от индекса обучения Canton-S. Таким образом, для успешности обучения самцам линий Berlin и Oregon R требуется большая длительность тренировки (5 ч) по сравнению с Canton-S, для которых достаточно 30 мин тренировки. В тоже время у agnts3 увеличение длительности тренировки не приводит к выработке условно-рефлекторного подавления ухаживания.

ЗАКЛЮЧЕНИЕ В настоящее время геномные заболевания часто вызывают поражения центральной нервной системы. Длительное время считалось, что синдром Уильямса является одной из наиболее привлекательных моделей, позволяющих связать гены, мозг и поведение (Jrvinen-Pasley et al., 2008). Кроме того, локомоторные нарушения, регистрируемые как при геномных заболеваниях, так и при нейродегенеративных болезнях, являются результатом десинхронизации мышечных волокон. Оба типа заболеваний, как выяснилось, являются спородическими и значимую роль в их генезисе играет дисрегуляция ремоделирования актина. Ключевой фермент этого каскада, LIMK1 и ее субстрат кофилин оказываются на перекрестке многих регуляторных путей (Bernstein and Bamburg, 2010). Если делеционный синдром Уильямса возникает в результате неравной рекомбинации в районе хромосом со специфической архитектурой и в когнитивных нарушениях принимает участие limk1, то у дрозофилы этот ген также расположен в районе со специфичной архитектурой хромосомы, в локусе agnostic.

Наличие А/Т-богатых областей вблизи локуса предрасполагает к возникновению спонтанных перестроек в разных природных популяциях. К их числу относятся линии дикого типа Canton-S, Berlin и Oregon-R. Эти линии вместе с ЭМС индуцированным температуро-чувствительным мутантом agnts3 служат удобной моделью для комбинирования на D. melanogaster молекулярно-генетических, физиологических и ультраструктурных (гистологических) методов анализа (Schmid, Sigrist, 2008). Комплексный анализ полиморфных вариантов и индуцированной мутации гена limk1 позволил обозначить вклад мутационных изменений регуляторной и структурной области гена limk1 и характера его экспрессии на разных уровнях в реализацию моторных функций и в формирование различных форм памяти. Поскольку молекулярные механизмы обучения и памяти консервативны среди организмов, находящихся на разных филогенетических уровнях, на мутантных линиях дрозофилы можно оценить вклад мутаций определенного гена в эти процессы. Это создаёт предпосылки для скрининга фармакологических агентов при восстановительной терапии.

ВЫВОДЫ 1. Линии Сanton-S, Berlin и Oregon-R, при сопоставимом суммарном содержании LIMK1, характеризуются различным соотношением D- и C-изоформ. Для agnts показано более высокое содержание D- и С-изоформ LIMK1 по сравнению с Сanton-S при неизменном их соотношении.

2. В 5’-регуляторной и структурной областях гена limk1 у Canton-S и Berlin обнаружены однонуклеотидные полиморфизмы, которые у Oregon-R и agnts закреплены в форме однонуклеотидных замен. Инсерция в интроне 1 гена limk1 у Oregon-R и agnts3 обуславливает формирование микро РНК гомологичной микро РНК dme-mir-1006, способной регулировать звукопродукцию и формирование памяти.

3. Амилоидные включения с наибольшей частотой встречается у имаго самцов agnts3 в зоне тонких отростков аксонов 2-го типа II дорзального нерва мезоторакального сегмента самцов. р-кофилин распределен вненейронально у линий Canton-S, Berlin, Oregon-R и agnts3 и его локализация не изменяется при обучении. pCREB характеризуется различной локализацией у Canton-S и agnts3 и одинаковой у линий Berlin и Oregon-R до и после обучения.

4. В реализации параметров звукопродукции, поведения ухаживания и формирования памяти лежат общие механизмы. Изменения межимпульсного интервала и основной частоты синусоидальной песни у Berlin, Oregon-R и agnts сопровождается нарушением формирования памяти. Для линии Berlin также характерно снижение эффективности ухаживания.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ СТАТЬИ:

1. А.В. Попов, А.Н. Каминская, Е.В. Савватеева-Попова Поведение ухаживания коммуникационное звукоизлучение и устойчивость к стрессу самцов Drosophila melanogaster линии agnostic – мутантов по гену limk1 // Журнал эволюционной биохимии и физиологии. – 2009. – Т. 45 (2). – С.184-190.

2. Каминская А.Н., Никитина Е.К., Паялина Т.Л., Молотков Д.А., Захаров Г.А., Попов А.В., Савватеева-Попова Е.В. Влияние соотношения изоформ LIMK на поведение ухаживания Drosophila melanogaster: комплексный подход // Экологическая генетика. – 2011. – Т. 9 (4). – С. 3-14.

ИЗБРАННЫЕ ТЕЗИСЫ:

1. А.Н. Каминская, Д.А. Молотков, А.В. Попов, Е.В. Савватеева-Попова LIMK в регуляции мутантов agnts3 Drosophila melanogaster // Научное наследие академика Л.А. Орбели. Структурные и функциональные основы эволюции функций, физиология экстремальных состояний. – Санкт-Петербург, 2008 – С.62.

2. Молотков Д.А., Каминская А.Н., Попов А.В., Саватеева-Попова Е.В.

Механизмы развития патологических состояний нервной системы: анализ на мутационных моделях дрозофилы и пчелы: LIMK1 в реализации полового поведения мутантных и спонтанных вариантов гена agnostic // Динамика генофондов «Биоразнообразие и динамика генофондов». – Москва, 2008. – C.154-156.

3. Каминская А.Н. LIMK1 в реализации полового поведения и коммуникационного звукоизлучения мутантных и спонтанных вариантов локуса agnostic Drosophila melanogaster // Международная конференция студентов, аспирантов и молодых ученых «Ломоносов-2009». – Москва, 2009.

– С.127.

4. А.Н. Каминская, Д.А. Молотков, А.В. Попов, Е.В. Савватеева-Попова Влияние теплового шока на поведение и содержание LIMK1 в мозге самцов D.

melanogaster мутантной линии agnts3 // Съезд генетиков и селекционеров, посвященный 200-летию со дня рождения Ч. Дарвина и Пятый съезд Вавиловского общества генетиков и селекционеров. – Москва. 2009. – С.116.

5. Kaminskaya A.N., Pain S.V., Nikitina E.A., Popov A.V., Savvateeva-Popova E.V.

An attempt of using setup for automatic registration of communicative sound signals for analysis of learning in conditioned courtship in Drosophila // IX Conference of International Society of Invertebrate Neurobiology (ISIN) “Simpler Nervous Systems”. – Saint-Petersburg, 2009. – P.49-50.

Kaminskaya A.N., Shchekanov E.E., Savvateeva-Popova E.V. Development of a 6.

Drosophila model for cofilin-mediated neurodegenerative disease // VI International interdisciplinary congress «Neuroscience for medicine and psychology» Sudak, Crimea, Ukraine, 2010. – P.152.

Savvateeva-Popova E., Nikitina E., Tokmatcheva E., Medvedeva A., Kaminskaya 7.

A., Zhuravlev A., Zakharov G., Dolgaya Y. Drosophila model for studies of micro RNA regulation of LIMK1 gene, intermediate and long-term memory and chromatin organization // 7th Forum of European Neuroscience. –Amsterdam, The Netherlands, 2010 – V.5, 057.81.

Каминская А.Н., Паялина Т.Л., Савватеева-Попова Е.В. Мутантные и 8.

спонтанные варианты локуса agnostic Drosophila melanogaster при разработке модели кофилинопатий // IV Международная школа молодых ученых по молекулярной генетике «Геномика и биология клетки». – Москва, Звенигород, 2010. – С. 15-16.

Каминская А.Н., Паялина Т.Л., Савватеева-Попова Е.В. Использование 9.

установки автоматической регистрации сигналов ухаживания для изучения роли LIMK1 в обучении Drosophila melanogaster // Конференция молодых ученых «Механизмы адаптации физиологических систем организма к факторам среды, посвященная 85-летию со дня основания Института физиологии им. И.П. Павлова РАН. – Санкт-Петербург, 2010. – С.51.

Kaminskaya A.N., Payalina T.L., Savvateeva-Popova E.V. Mutational and 10.

spontaneous variants of the agnostic locus in development of cofilin-mediated neurodegenerative diseases // The 10th International Conference on Alzheimer's & Parkinson's disease. – Barcelona, Spain, 2011. – P.1171.

A.N.Kaminskaya, T.L.Payalina, A.V.Medvedeva, E.A.Nikitina, E.V.Savvateeva 11.

Popova Adult thoracic neuromuscular junction of Drosophila: are pCREB and pCofilin glial or neural? // III International Symposium «Topical problems of biophotonics -2011». – St. Peterburg – Nizhny Novgorod, 2011. – P. 251-252.

Kaminskaya A.N., Medvedeva A.V., Payalina T.V. and Savvateeva-Popova E.V.

12.

LIMK1 and PCREB at learning process in induced and spontaneous mutants of the Drosophila melanogaster limk1 gene. // Journal of Neurochemistry (23rd Biennial Meeting ISN-ESN-2011). – Athens, Greece, 2011 – V. 118. S.1 – P. 160-161.

Савватеева-Попова Е.В., Журавлев А.В., Захаров Г.А., Каминская А.Н., 13.

Медведева А.В. От последовательности гена для LIMK1, ключевого фермента ремоделирования актина, к нейрогеномике и эпигенетике // III съезд физиологов СНГ. – Ялта Украина, 2011. – С. 128.

14. Каминская А.Н., Медведева А.В., Савватеева-Попова Е.В. Распределение pCofilin, pCREB и амилоидных включений в области нейромышечных контактов у мутантной линии agnts3 D.melanogaster //Журнал Цитология (Труды I Всероссийской конференции "Внутриклеточная сигнализация, транспорт, цитоскелет"). - Санкт-Петербург, 2011. – Т. 53 (9). – С. 705.

15. Каминская А.Н., Паялина Т.Л., Савватеева-Попова Е.В. Природный полиморфизм гена limk1 в обучении Drosophila melanogaster // Международная молодежная конференция «Популяционная генетика:

современное состояние и перспективы». – Москва, 2011. – С. 201.

16. Каминская А.Н., Медведева А.В., Паялина Т.Л., Савватеева-Попова Е.В.

Влияние мутаций в гене limk1 на характер распределения p-CREВ области нейромышечных контактов при нейродегенерации // Медицинский Академический журнал (Труды Всероссийской молодежной конференции школы «Нейробиология интегративных функций мозга»). – Санкт-Петербург 2011 – Т.11. – С.29.



 

Похожие работы:





 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.